Incidental Mutation 'R4095:Tmem104'
ID317869
Institutional Source Beutler Lab
Gene Symbol Tmem104
Ensembl Gene ENSMUSG00000045980
Gene Nametransmembrane protein 104
SynonymsC630005D06Rik
MMRRC Submission 040858-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R4095 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115187487-115247023 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 115243923 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 427 (Y427*)
Ref Sequence ENSEMBL: ENSMUSP00000097807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061450] [ENSMUST00000100235]
Predicted Effect probably null
Transcript: ENSMUST00000061450
AA Change: Y428*
SMART Domains Protein: ENSMUSP00000056805
Gene: ENSMUSG00000045980
AA Change: Y428*

DomainStartEndE-ValueType
Pfam:Aa_trans 13 77 3.4e-10 PFAM
low complexity region 84 100 N/A INTRINSIC
Pfam:Aa_trans 128 487 4.5e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100235
AA Change: Y427*
SMART Domains Protein: ENSMUSP00000097807
Gene: ENSMUSG00000045980
AA Change: Y427*

DomainStartEndE-ValueType
Pfam:Aa_trans 13 81 5.5e-11 PFAM
low complexity region 84 100 N/A INTRINSIC
Pfam:Aa_trans 127 485 1.2e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156230
Meta Mutation Damage Score 0.63 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 A T 12: 53,139,462 I1220L probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Apba1 A T 19: 23,944,024 Q737L probably benign Het
Arvcf T A 16: 18,401,577 D564E probably damaging Het
Bcl11b G T 12: 107,916,835 P335Q probably damaging Het
Brd9 G A 13: 73,944,799 V302I probably benign Het
Brinp3 C A 1: 146,901,692 H626N possibly damaging Het
C1qc T C 4: 136,890,326 N153S probably benign Het
Casp3 G A 8: 46,634,216 G66D probably damaging Het
Coq7 T G 7: 118,527,478 probably null Het
Dach1 C T 14: 97,901,379 V491M possibly damaging Het
Dda1 A G 8: 71,473,792 T52A possibly damaging Het
Entpd7 A G 19: 43,704,201 Y65C probably damaging Het
Fmnl2 A G 2: 53,101,523 D350G probably damaging Het
Foxn3 G T 12: 99,196,441 D400E probably damaging Het
Gbp2 A G 3: 142,637,449 T576A probably benign Het
Gm15446 T A 5: 109,940,724 probably null Het
Gtf2a1 G T 12: 91,575,637 T57K possibly damaging Het
Hps5 T C 7: 46,775,794 E494G probably benign Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Hydin A G 8: 110,541,547 N2886S probably damaging Het
Ighv2-6-8 T C 12: 113,796,153 Y112C probably damaging Het
Kcnf1 A T 12: 17,175,479 L247Q possibly damaging Het
Kndc1 A G 7: 139,937,025 M1606V possibly damaging Het
Krt27 T C 11: 99,345,793 T431A probably benign Het
Lama4 A T 10: 39,097,122 I1562F probably damaging Het
Lrig1 T C 6: 94,613,578 D487G probably benign Het
Lrp1b G A 2: 41,449,191 T880I probably benign Het
Ltbp4 A G 7: 27,325,216 V663A possibly damaging Het
Mapt T C 11: 104,310,536 probably null Het
Mpdz A T 4: 81,383,823 V229D possibly damaging Het
Olfr1349 T A 7: 6,515,253 S59C possibly damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr49 T C 14: 54,282,731 T55A probably benign Het
Parm1 T C 5: 91,594,180 S136P probably benign Het
Pcdhgb2 T A 18: 37,690,950 S331R probably benign Het
Pdxk T C 10: 78,464,810 H13R probably damaging Het
Ppp1r12c T C 7: 4,483,367 E601G probably damaging Het
Rell1 C A 5: 63,968,670 V22L probably benign Het
Sema6c T A 3: 95,173,194 L901Q probably benign Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc22a23 A G 13: 34,305,206 L116P probably damaging Het
Slit1 A T 19: 41,608,486 probably benign Het
Spns1 T C 7: 126,370,786 T481A probably damaging Het
Tmem74 G A 15: 43,867,282 Q122* probably null Het
Tnpo2 T A 8: 85,038,419 L10Q probably damaging Het
Trav6-2 G T 14: 52,667,815 A98S probably benign Het
Ttll5 A T 12: 85,956,602 R214* probably null Het
Ube2b A C 11: 51,997,827 V39G possibly damaging Het
Vmn1r185 A T 7: 26,611,783 V99E probably damaging Het
Wnk1 G A 6: 119,948,126 T1459I probably damaging Het
Zc3h7a T C 16: 11,145,235 K754R probably damaging Het
Zfp605 A G 5: 110,127,736 K240R probably damaging Het
Zfp61 A G 7: 24,291,275 probably null Het
Other mutations in Tmem104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Tmem104 APN 11 115243937 missense probably damaging 1.00
IGL02948:Tmem104 APN 11 115197296 missense probably damaging 1.00
IGL03010:Tmem104 APN 11 115243534 missense probably benign 0.01
R0107:Tmem104 UTSW 11 115202180 missense probably damaging 1.00
R0399:Tmem104 UTSW 11 115201308 splice site probably benign
R0534:Tmem104 UTSW 11 115200828 missense probably damaging 1.00
R2034:Tmem104 UTSW 11 115243547 missense probably benign 0.42
R2037:Tmem104 UTSW 11 115201395 missense possibly damaging 0.95
R4640:Tmem104 UTSW 11 115243724 missense probably damaging 1.00
R4981:Tmem104 UTSW 11 115205136 missense probably damaging 1.00
R5011:Tmem104 UTSW 11 115243486 missense probably damaging 1.00
R5086:Tmem104 UTSW 11 115201401 missense probably damaging 0.98
R5522:Tmem104 UTSW 11 115188323 critical splice donor site probably null
R5602:Tmem104 UTSW 11 115205124 missense probably damaging 1.00
R6025:Tmem104 UTSW 11 115205523 nonsense probably null
R6247:Tmem104 UTSW 11 115243993 missense probably benign
R6522:Tmem104 UTSW 11 115243753 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTGTTCACCATCAGCAC -3'
(R):5'- GGTCTCCTTGAGGACGATGTAG -3'

Sequencing Primer
(F):5'- GTGTTCACCATCAGCACCAACTTC -3'
(R):5'- GACGATGTAGGCCGTGAC -3'
Posted On2015-05-15