Incidental Mutation 'R4095:Slc22a23'
ID317877
Institutional Source Beutler Lab
Gene Symbol Slc22a23
Ensembl Gene ENSMUSG00000038267
Gene Namesolute carrier family 22, member 23
Synonyms3110004L20Rik
MMRRC Submission 040858-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock #R4095 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location34179158-34345182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34305206 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 116 (L116P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040336]
Predicted Effect probably damaging
Transcript: ENSMUST00000040336
AA Change: L232P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042742
Gene: ENSMUSG00000038267
AA Change: L232P

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
Pfam:Sugar_tr 187 633 5e-26 PFAM
Pfam:MFS_1 224 518 2.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143353
Predicted Effect probably benign
Transcript: ENSMUST00000145038
SMART Domains Protein: ENSMUSP00000122376
Gene: ENSMUSG00000038267

DomainStartEndE-ValueType
low complexity region 86 97 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000148390
AA Change: L116P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122283
Gene: ENSMUSG00000038267
AA Change: L116P

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
Pfam:Sugar_tr 71 510 1.4e-27 PFAM
Pfam:MFS_1 109 402 1.5e-12 PFAM
Meta Mutation Damage Score 0.246 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC22A23 belongs to a large family of transmembrane proteins that function as uniporters, symporters, and antiporters to transport organic ions across cell membranes (Jacobsson et al., 2007 [PubMed 17714910]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 A T 12: 53,139,462 I1220L probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Apba1 A T 19: 23,944,024 Q737L probably benign Het
Arvcf T A 16: 18,401,577 D564E probably damaging Het
Bcl11b G T 12: 107,916,835 P335Q probably damaging Het
Brd9 G A 13: 73,944,799 V302I probably benign Het
Brinp3 C A 1: 146,901,692 H626N possibly damaging Het
C1qc T C 4: 136,890,326 N153S probably benign Het
Casp3 G A 8: 46,634,216 G66D probably damaging Het
Coq7 T G 7: 118,527,478 probably null Het
Dach1 C T 14: 97,901,379 V491M possibly damaging Het
Dda1 A G 8: 71,473,792 T52A possibly damaging Het
Entpd7 A G 19: 43,704,201 Y65C probably damaging Het
Fmnl2 A G 2: 53,101,523 D350G probably damaging Het
Foxn3 G T 12: 99,196,441 D400E probably damaging Het
Gbp2 A G 3: 142,637,449 T576A probably benign Het
Gm15446 T A 5: 109,940,724 probably null Het
Gtf2a1 G T 12: 91,575,637 T57K possibly damaging Het
Hps5 T C 7: 46,775,794 E494G probably benign Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Hydin A G 8: 110,541,547 N2886S probably damaging Het
Ighv2-6-8 T C 12: 113,796,153 Y112C probably damaging Het
Kcnf1 A T 12: 17,175,479 L247Q possibly damaging Het
Kndc1 A G 7: 139,937,025 M1606V possibly damaging Het
Krt27 T C 11: 99,345,793 T431A probably benign Het
Lama4 A T 10: 39,097,122 I1562F probably damaging Het
Lrig1 T C 6: 94,613,578 D487G probably benign Het
Lrp1b G A 2: 41,449,191 T880I probably benign Het
Ltbp4 A G 7: 27,325,216 V663A possibly damaging Het
Mapt T C 11: 104,310,536 probably null Het
Mpdz A T 4: 81,383,823 V229D possibly damaging Het
Olfr1349 T A 7: 6,515,253 S59C possibly damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr49 T C 14: 54,282,731 T55A probably benign Het
Parm1 T C 5: 91,594,180 S136P probably benign Het
Pcdhgb2 T A 18: 37,690,950 S331R probably benign Het
Pdxk T C 10: 78,464,810 H13R probably damaging Het
Ppp1r12c T C 7: 4,483,367 E601G probably damaging Het
Rell1 C A 5: 63,968,670 V22L probably benign Het
Sema6c T A 3: 95,173,194 L901Q probably benign Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slit1 A T 19: 41,608,486 probably benign Het
Spns1 T C 7: 126,370,786 T481A probably damaging Het
Tmem104 T A 11: 115,243,923 Y427* probably null Het
Tmem74 G A 15: 43,867,282 Q122* probably null Het
Tnpo2 T A 8: 85,038,419 L10Q probably damaging Het
Trav6-2 G T 14: 52,667,815 A98S probably benign Het
Ttll5 A T 12: 85,956,602 R214* probably null Het
Ube2b A C 11: 51,997,827 V39G possibly damaging Het
Vmn1r185 A T 7: 26,611,783 V99E probably damaging Het
Wnk1 G A 6: 119,948,126 T1459I probably damaging Het
Zc3h7a T C 16: 11,145,235 K754R probably damaging Het
Zfp605 A G 5: 110,127,736 K240R probably damaging Het
Zfp61 A G 7: 24,291,275 probably null Het
Other mutations in Slc22a23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Slc22a23 APN 13 34305245 missense probably damaging 1.00
IGL01762:Slc22a23 APN 13 34204001 missense possibly damaging 0.71
IGL02496:Slc22a23 APN 13 34344485 missense possibly damaging 0.93
IGL02516:Slc22a23 APN 13 34203955 missense probably benign 0.02
IGL02831:Slc22a23 APN 13 34299069 missense possibly damaging 0.81
R0234:Slc22a23 UTSW 13 34183261 missense probably damaging 1.00
R0234:Slc22a23 UTSW 13 34183261 missense probably damaging 1.00
R0413:Slc22a23 UTSW 13 34183132 missense probably damaging 1.00
R0557:Slc22a23 UTSW 13 34344383 missense possibly damaging 0.50
R0558:Slc22a23 UTSW 13 34344383 missense possibly damaging 0.50
R0636:Slc22a23 UTSW 13 34299093 missense probably benign 0.01
R0676:Slc22a23 UTSW 13 34195479 missense probably damaging 0.98
R0739:Slc22a23 UTSW 13 34344383 missense possibly damaging 0.50
R0990:Slc22a23 UTSW 13 34195467 missense probably damaging 1.00
R1515:Slc22a23 UTSW 13 34203964 missense probably benign 0.33
R2128:Slc22a23 UTSW 13 34203970 missense possibly damaging 0.76
R2147:Slc22a23 UTSW 13 34183007 missense probably benign 0.00
R3113:Slc22a23 UTSW 13 34183075 missense probably damaging 0.98
R3780:Slc22a23 UTSW 13 34344340 missense probably benign 0.14
R3945:Slc22a23 UTSW 13 34183126 missense probably damaging 0.98
R3946:Slc22a23 UTSW 13 34183126 missense probably damaging 0.98
R4056:Slc22a23 UTSW 13 34299004 nonsense probably null
R4854:Slc22a23 UTSW 13 34203941 missense probably benign
R5594:Slc22a23 UTSW 13 34305257 missense probably damaging 0.99
R5611:Slc22a23 UTSW 13 34305239 missense probably benign 0.00
R6167:Slc22a23 UTSW 13 34344559 missense probably damaging 0.97
R6927:Slc22a23 UTSW 13 34344379 missense probably benign 0.07
R6933:Slc22a23 UTSW 13 34305180 missense probably benign 0.08
R6960:Slc22a23 UTSW 13 34344157 critical splice donor site probably null
X0064:Slc22a23 UTSW 13 34344466 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGTCAGCTTCTCTTCTGGC -3'
(R):5'- CAGCAGCCCACGATGATATTC -3'

Sequencing Primer
(F):5'- AGCTTCTCTTCTGGCATCAGTGG -3'
(R):5'- CGATGATATTCTTCGTGGCAC -3'
Posted On2015-05-15