Incidental Mutation 'R4095:Olfr49'
ID317880
Institutional Source Beutler Lab
Gene Symbol Olfr49
Ensembl Gene ENSMUSG00000048153
Gene Nameolfactory receptor 49
SynonymsMOR118-1, IC6, GA_x6K02T2QVSB-39745261-39746202
MMRRC Submission 040858-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4095 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location54278253-54284939 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54282731 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 55 (T55A)
Ref Sequence ENSEMBL: ENSMUSP00000149840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059996] [ENSMUST00000216214]
Predicted Effect probably benign
Transcript: ENSMUST00000059996
AA Change: T55A

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000054361
Gene: ENSMUSG00000048153
AA Change: T55A

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 4.4e-51 PFAM
Pfam:7tm_1 39 289 3.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216214
AA Change: T55A

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.1128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 A T 12: 53,139,462 I1220L probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Apba1 A T 19: 23,944,024 Q737L probably benign Het
Arvcf T A 16: 18,401,577 D564E probably damaging Het
Bcl11b G T 12: 107,916,835 P335Q probably damaging Het
Brd9 G A 13: 73,944,799 V302I probably benign Het
Brinp3 C A 1: 146,901,692 H626N possibly damaging Het
C1qc T C 4: 136,890,326 N153S probably benign Het
Casp3 G A 8: 46,634,216 G66D probably damaging Het
Coq7 T G 7: 118,527,478 probably null Het
Dach1 C T 14: 97,901,379 V491M possibly damaging Het
Dda1 A G 8: 71,473,792 T52A possibly damaging Het
Entpd7 A G 19: 43,704,201 Y65C probably damaging Het
Fmnl2 A G 2: 53,101,523 D350G probably damaging Het
Foxn3 G T 12: 99,196,441 D400E probably damaging Het
Gbp2 A G 3: 142,637,449 T576A probably benign Het
Gm15446 T A 5: 109,940,724 probably null Het
Gtf2a1 G T 12: 91,575,637 T57K possibly damaging Het
Hps5 T C 7: 46,775,794 E494G probably benign Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Hydin A G 8: 110,541,547 N2886S probably damaging Het
Ighv2-6-8 T C 12: 113,796,153 Y112C probably damaging Het
Kcnf1 A T 12: 17,175,479 L247Q possibly damaging Het
Kndc1 A G 7: 139,937,025 M1606V possibly damaging Het
Krt27 T C 11: 99,345,793 T431A probably benign Het
Lama4 A T 10: 39,097,122 I1562F probably damaging Het
Lrig1 T C 6: 94,613,578 D487G probably benign Het
Lrp1b G A 2: 41,449,191 T880I probably benign Het
Ltbp4 A G 7: 27,325,216 V663A possibly damaging Het
Mapt T C 11: 104,310,536 probably null Het
Mpdz A T 4: 81,383,823 V229D possibly damaging Het
Olfr1349 T A 7: 6,515,253 S59C possibly damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Parm1 T C 5: 91,594,180 S136P probably benign Het
Pcdhgb2 T A 18: 37,690,950 S331R probably benign Het
Pdxk T C 10: 78,464,810 H13R probably damaging Het
Ppp1r12c T C 7: 4,483,367 E601G probably damaging Het
Rell1 C A 5: 63,968,670 V22L probably benign Het
Sema6c T A 3: 95,173,194 L901Q probably benign Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc22a23 A G 13: 34,305,206 L116P probably damaging Het
Slit1 A T 19: 41,608,486 probably benign Het
Spns1 T C 7: 126,370,786 T481A probably damaging Het
Tmem104 T A 11: 115,243,923 Y427* probably null Het
Tmem74 G A 15: 43,867,282 Q122* probably null Het
Tnpo2 T A 8: 85,038,419 L10Q probably damaging Het
Trav6-2 G T 14: 52,667,815 A98S probably benign Het
Ttll5 A T 12: 85,956,602 R214* probably null Het
Ube2b A C 11: 51,997,827 V39G possibly damaging Het
Vmn1r185 A T 7: 26,611,783 V99E probably damaging Het
Wnk1 G A 6: 119,948,126 T1459I probably damaging Het
Zc3h7a T C 16: 11,145,235 K754R probably damaging Het
Zfp605 A G 5: 110,127,736 K240R probably damaging Het
Zfp61 A G 7: 24,291,275 probably null Het
Other mutations in Olfr49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Olfr49 APN 14 54282724 missense probably damaging 1.00
IGL02197:Olfr49 APN 14 54281952 makesense probably null
PIT4581001:Olfr49 UTSW 14 54282538 missense probably damaging 1.00
R4673:Olfr49 UTSW 14 54282332 missense possibly damaging 0.71
R4795:Olfr49 UTSW 14 54282547 missense probably damaging 1.00
R4867:Olfr49 UTSW 14 54282629 missense probably benign 0.21
R5206:Olfr49 UTSW 14 54282698 missense probably benign
R5567:Olfr49 UTSW 14 54282368 missense probably damaging 1.00
R5570:Olfr49 UTSW 14 54282368 missense probably damaging 1.00
R5806:Olfr49 UTSW 14 54282807 missense probably benign
R5848:Olfr49 UTSW 14 54282565 missense possibly damaging 0.90
R7012:Olfr49 UTSW 14 54282217 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- AGAACTCAGTGGTGCCAAG -3'
(R):5'- GTGTTGTCCTCAGAGCTCAC -3'

Sequencing Primer
(F):5'- CTCAGTGGTGCCAAGGAAGAAATAG -3'
(R):5'- AGCTCACAGGCTCTGATGCTC -3'
Posted On2015-05-15