Incidental Mutation 'R4095:Apba1'
ID317888
Institutional Source Beutler Lab
Gene Symbol Apba1
Ensembl Gene ENSMUSG00000024897
Gene Nameamyloid beta (A4) precursor protein binding, family A, member 1
Synonyms6430513E09Rik, Lin-10, X11, Mint, Mint1, X11alpha
MMRRC Submission 040858-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4095 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location23758876-23949597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23944024 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 737 (Q737L)
Ref Sequence ENSEMBL: ENSMUSP00000025830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025830]
Predicted Effect probably benign
Transcript: ENSMUST00000025830
AA Change: Q737L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000025830
Gene: ENSMUSG00000024897
AA Change: Q737L

DomainStartEndE-ValueType
low complexity region 40 47 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
low complexity region 404 421 N/A INTRINSIC
PTB 461 626 9.49e-33 SMART
PDZ 670 748 3.09e-15 SMART
PDZ 762 828 2.53e-11 SMART
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals carrying a homozygous mutation of this gene have reduced body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 A T 12: 53,139,462 I1220L probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Arvcf T A 16: 18,401,577 D564E probably damaging Het
Bcl11b G T 12: 107,916,835 P335Q probably damaging Het
Brd9 G A 13: 73,944,799 V302I probably benign Het
Brinp3 C A 1: 146,901,692 H626N possibly damaging Het
C1qc T C 4: 136,890,326 N153S probably benign Het
Casp3 G A 8: 46,634,216 G66D probably damaging Het
Coq7 T G 7: 118,527,478 probably null Het
Dach1 C T 14: 97,901,379 V491M possibly damaging Het
Dda1 A G 8: 71,473,792 T52A possibly damaging Het
Entpd7 A G 19: 43,704,201 Y65C probably damaging Het
Fmnl2 A G 2: 53,101,523 D350G probably damaging Het
Foxn3 G T 12: 99,196,441 D400E probably damaging Het
Gbp2 A G 3: 142,637,449 T576A probably benign Het
Gm15446 T A 5: 109,940,724 probably null Het
Gtf2a1 G T 12: 91,575,637 T57K possibly damaging Het
Hps5 T C 7: 46,775,794 E494G probably benign Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Hydin A G 8: 110,541,547 N2886S probably damaging Het
Ighv2-6-8 T C 12: 113,796,153 Y112C probably damaging Het
Kcnf1 A T 12: 17,175,479 L247Q possibly damaging Het
Kndc1 A G 7: 139,937,025 M1606V possibly damaging Het
Krt27 T C 11: 99,345,793 T431A probably benign Het
Lama4 A T 10: 39,097,122 I1562F probably damaging Het
Lrig1 T C 6: 94,613,578 D487G probably benign Het
Lrp1b G A 2: 41,449,191 T880I probably benign Het
Ltbp4 A G 7: 27,325,216 V663A possibly damaging Het
Mapt T C 11: 104,310,536 probably null Het
Mpdz A T 4: 81,383,823 V229D possibly damaging Het
Olfr1349 T A 7: 6,515,253 S59C possibly damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr49 T C 14: 54,282,731 T55A probably benign Het
Parm1 T C 5: 91,594,180 S136P probably benign Het
Pcdhgb2 T A 18: 37,690,950 S331R probably benign Het
Pdxk T C 10: 78,464,810 H13R probably damaging Het
Ppp1r12c T C 7: 4,483,367 E601G probably damaging Het
Rell1 C A 5: 63,968,670 V22L probably benign Het
Sema6c T A 3: 95,173,194 L901Q probably benign Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc22a23 A G 13: 34,305,206 L116P probably damaging Het
Slit1 A T 19: 41,608,486 probably benign Het
Spns1 T C 7: 126,370,786 T481A probably damaging Het
Tmem104 T A 11: 115,243,923 Y427* probably null Het
Tmem74 G A 15: 43,867,282 Q122* probably null Het
Tnpo2 T A 8: 85,038,419 L10Q probably damaging Het
Trav6-2 G T 14: 52,667,815 A98S probably benign Het
Ttll5 A T 12: 85,956,602 R214* probably null Het
Ube2b A C 11: 51,997,827 V39G possibly damaging Het
Vmn1r185 A T 7: 26,611,783 V99E probably damaging Het
Wnk1 G A 6: 119,948,126 T1459I probably damaging Het
Zc3h7a T C 16: 11,145,235 K754R probably damaging Het
Zfp605 A G 5: 110,127,736 K240R probably damaging Het
Zfp61 A G 7: 24,291,275 probably null Het
Other mutations in Apba1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Apba1 APN 19 23917586 missense possibly damaging 0.95
IGL01991:Apba1 APN 19 23937472 missense possibly damaging 0.80
IGL02048:Apba1 APN 19 23937636 splice site probably null
IGL02522:Apba1 APN 19 23912445 splice site probably benign
IGL02728:Apba1 APN 19 23944905 missense possibly damaging 0.93
IGL02942:Apba1 APN 19 23944971 missense possibly damaging 0.78
IGL03349:Apba1 APN 19 23917575 missense probably benign 0.02
IGL03410:Apba1 APN 19 23937581 missense possibly damaging 0.67
R0052:Apba1 UTSW 19 23915951 missense possibly damaging 0.90
R0052:Apba1 UTSW 19 23915951 missense possibly damaging 0.90
R0084:Apba1 UTSW 19 23912497 missense possibly damaging 0.68
R0379:Apba1 UTSW 19 23934830 missense probably damaging 1.00
R0423:Apba1 UTSW 19 23944998 missense probably damaging 1.00
R1132:Apba1 UTSW 19 23917553 missense possibly damaging 0.83
R1291:Apba1 UTSW 19 23917672 missense probably damaging 0.97
R1681:Apba1 UTSW 19 23936561 missense probably damaging 1.00
R1714:Apba1 UTSW 19 23944952 missense possibly damaging 0.67
R1756:Apba1 UTSW 19 23893692 missense possibly damaging 0.83
R1866:Apba1 UTSW 19 23892831 missense probably benign 0.22
R2076:Apba1 UTSW 19 23893223 nonsense probably null
R2217:Apba1 UTSW 19 23893962 missense probably damaging 0.99
R3907:Apba1 UTSW 19 23937506 missense probably damaging 0.96
R4529:Apba1 UTSW 19 23936535 missense probably damaging 1.00
R4557:Apba1 UTSW 19 23917592 missense probably damaging 1.00
R4972:Apba1 UTSW 19 23912536 missense probably benign 0.24
R5521:Apba1 UTSW 19 23893593 missense probably damaging 1.00
R6539:Apba1 UTSW 19 23936560 missense probably damaging 1.00
R7032:Apba1 UTSW 19 23912461 missense probably benign 0.20
R7035:Apba1 UTSW 19 23917567 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGTGAAGATGCCATCCACAGG -3'
(R):5'- CCCCAAACGTCTTTATTGGATG -3'

Sequencing Primer
(F):5'- TCTCACACAGACTGGGCG -3'
(R):5'- CCCAAACGTCTTTATTGGATGAAAAG -3'
Posted On2015-05-15