Incidental Mutation 'R0393:Cyp2b10'
ID31792
Institutional Source Beutler Lab
Gene Symbol Cyp2b10
Ensembl Gene ENSMUSG00000030483
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 10
Synonymsphenobarbitol inducible, type b, p16, Cyp2b20, Cyp2b
MMRRC Submission 038599-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R0393 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25897620-25926624 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 25914934 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000072264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005477] [ENSMUST00000072438]
Predicted Effect probably benign
Transcript: ENSMUST00000005477
SMART Domains Protein: ENSMUSP00000005477
Gene: ENSMUSG00000030483

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:p450 31 497 4.1e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072438
SMART Domains Protein: ENSMUSP00000072264
Gene: ENSMUSG00000030483

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:p450 31 488 2e-152 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144140
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP2B6, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by phenobarbital. The enzyme is known to metabolize some xenobiotics, such as the anti-cancer drugs cyclophosphamide and ifosphamide. Transcript variants for this gene have been described; however, it has not been resolved whether these transcripts are in fact produced by this gene or by a closely related pseudogene, CYP2B7. Both the gene and the pseudogene are located in the middle of a CYP2A pseudogene found in a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 C T 6: 142,645,878 probably benign Het
Akr1b7 T G 6: 34,415,400 Y49* probably null Het
Ankrd10 G T 8: 11,635,482 R46S possibly damaging Het
Atp13a5 A G 16: 29,266,929 probably benign Het
Baz1a A G 12: 54,918,436 probably null Het
Bicd2 C T 13: 49,379,870 T644M probably damaging Het
Ccr9 A T 9: 123,779,970 H239L probably benign Het
Cd180 A T 13: 102,705,900 N485Y probably damaging Het
Ces1d T A 8: 93,192,772 S131C probably damaging Het
Cnpy2 T A 10: 128,326,207 S116R probably benign Het
Crym T C 7: 120,189,749 K285R probably benign Het
Cyp2a4 A T 7: 26,312,868 I359F possibly damaging Het
Dcpp3 A T 17: 23,917,951 probably benign Het
Dnah8 T A 17: 30,708,390 I1340K probably benign Het
Fbln1 T C 15: 85,227,076 C144R probably damaging Het
Gm1553 T C 10: 82,492,176 R66G unknown Het
Il10rb G A 16: 91,412,010 V103I probably benign Het
Irak1bp1 T A 9: 82,846,561 W182R probably benign Het
Kcna3 T C 3: 107,036,999 S193P probably damaging Het
Kif14 C T 1: 136,482,418 H628Y probably damaging Het
Krt31 A G 11: 100,050,253 L77P probably damaging Het
Krt36 C T 11: 100,104,114 A211T possibly damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Lmo7 A G 14: 101,900,456 T743A probably benign Het
Lyst C T 13: 13,647,079 T1346M probably benign Het
Mapkbp1 T A 2: 120,012,903 probably null Het
Mif T C 10: 75,859,804 D55G probably benign Het
Mlh3 G T 12: 85,267,587 C608* probably null Het
Mlip A T 9: 77,239,577 C85S probably benign Het
Mug1 T C 6: 121,849,850 S211P possibly damaging Het
Mybl2 T A 2: 163,061,608 probably benign Het
Myh8 C T 11: 67,306,017 probably benign Het
Nanos1 A G 19: 60,756,930 Y222C probably damaging Het
Olfr1113 A T 2: 87,213,693 Y267F probably benign Het
Olfr1155 T C 2: 87,943,565 D21G possibly damaging Het
Olfr138 G T 17: 38,274,883 M37I probably benign Het
Papolb A G 5: 142,529,456 V144A probably damaging Het
Pctp A G 11: 89,986,119 S185P probably benign Het
Plod1 A T 4: 147,918,841 L509Q probably null Het
Ppp1r13b C A 12: 111,835,688 M290I probably benign Het
Ralb G C 1: 119,478,126 probably null Het
Slc4a8 T A 15: 100,774,638 D18E probably damaging Het
Speg A C 1: 75,423,924 H2576P possibly damaging Het
Spock1 T C 13: 57,440,536 D241G probably damaging Het
Tcam1 T A 11: 106,284,214 V165E probably benign Het
Thbs1 T A 2: 118,112,991 V30E possibly damaging Het
Tll2 A G 19: 41,088,826 Y834H possibly damaging Het
Tmem5 T C 10: 122,095,936 probably benign Het
Trpm6 G A 19: 18,778,644 D84N probably damaging Het
Ubr1 T A 2: 120,906,946 Q1039L probably damaging Het
Ubr4 A G 4: 139,410,860 probably benign Het
Vmn1r74 T C 7: 11,847,315 Y181H possibly damaging Het
Vmn2r13 T C 5: 109,156,529 T679A probably benign Het
Vmn2r91 A T 17: 18,105,450 Y110F probably damaging Het
Zbtb40 A C 4: 137,018,531 S64A probably benign Het
Zfp184 T A 13: 21,947,082 probably benign Het
Other mutations in Cyp2b10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02270:Cyp2b10 APN 7 25913937 missense probably damaging 0.99
IGL02341:Cyp2b10 APN 7 25911242 missense probably benign 0.33
IGL02557:Cyp2b10 APN 7 25914881 missense probably benign
R0038:Cyp2b10 UTSW 7 25914862 missense probably benign 0.21
R0569:Cyp2b10 UTSW 7 25897735 missense probably damaging 1.00
R1035:Cyp2b10 UTSW 7 25917048 missense probably benign 0.34
R1262:Cyp2b10 UTSW 7 25915411 missense probably benign 0.16
R1282:Cyp2b10 UTSW 7 25926080 missense probably damaging 1.00
R1452:Cyp2b10 UTSW 7 25925388 intron probably benign
R2163:Cyp2b10 UTSW 7 25925385 intron probably benign
R4520:Cyp2b10 UTSW 7 25911557 missense probably benign 0.05
R4831:Cyp2b10 UTSW 7 25915496 nonsense probably null
R5201:Cyp2b10 UTSW 7 25916994 missense probably damaging 1.00
R5330:Cyp2b10 UTSW 7 25913989 nonsense probably null
R5586:Cyp2b10 UTSW 7 25917012 missense probably damaging 1.00
R5964:Cyp2b10 UTSW 7 25926223 missense probably benign 0.28
R6043:Cyp2b10 UTSW 7 25917339 missense probably damaging 0.99
R6470:Cyp2b10 UTSW 7 25911656 missense possibly damaging 0.57
R6991:Cyp2b10 UTSW 7 25917355 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCCTGGTGCCCACAGACAAATCTC -3'
(R):5'- TCTGGACATTACTCAGCCCCAGAC -3'

Sequencing Primer
(F):5'- AGACAAATCTCCAAAAACCTGC -3'
(R):5'- GCCCCAGACAGTATCCCTTG -3'
Posted On2013-04-24