Incidental Mutation 'R1961:Kif27'
ID317958
Institutional Source Beutler Lab
Gene Symbol Kif27
Ensembl Gene ENSMUSG00000060176
Gene Namekinesin family member 27
Synonyms4930517I18Rik
MMRRC Submission 039975-MU
Accession Numbers

NCBI RefSeq: NM_175214.3; MGI:1922300

Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R1961 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location58287502-58359122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 58293123 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 1159 (R1159S)
Ref Sequence ENSEMBL: ENSMUSP00000153598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043605] [ENSMUST00000224694] [ENSMUST00000225388]
Predicted Effect probably benign
Transcript: ENSMUST00000043605
AA Change: R1159S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000043304
Gene: ENSMUSG00000060176
AA Change: R1159S

DomainStartEndE-ValueType
KISc 3 349 9.18e-160 SMART
low complexity region 369 385 N/A INTRINSIC
coiled coil region 386 418 N/A INTRINSIC
Blast:KISc 486 566 5e-29 BLAST
coiled coil region 710 790 N/A INTRINSIC
coiled coil region 835 891 N/A INTRINSIC
coiled coil region 916 972 N/A INTRINSIC
low complexity region 993 1008 N/A INTRINSIC
coiled coil region 1010 1078 N/A INTRINSIC
coiled coil region 1186 1226 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190479
Predicted Effect probably benign
Transcript: ENSMUST00000224694
Predicted Effect probably benign
Transcript: ENSMUST00000225388
AA Change: R1159S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 99% (93/94)
MGI Phenotype Strain: 4318693
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the KIF27 (kinesin 4) sub-family of the mammalian kinesin family. The gene is an ortholog of the Drosophila Cos2 gene, which plays an important role in the Hedgehog signaling pathway. The encoded protein contains an N-terminal motor domain which includes nucleotide-binding and microtubule-interacting regions, a stalk domain containing a predicted coiled coil motif and a C-terminal tail domain. Alternatively spliced transcript variants have been observed for this gene. Pseudogenes associated with this gene are located on chromosome 9. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous mice are small and die by 8 weeks and exhibit hydrocephalus, rhinitis and otitis media. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(2) Gene trapped(7)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,269 S265P possibly damaging Het
3110001I22Rik T A 16: 13,677,728 H230Q probably benign Het
Abcc1 T C 16: 14,396,393 Y191H probably damaging Het
Abcc4 C A 14: 118,611,456 G495C probably damaging Het
Abcc4 C A 14: 118,611,459 V494L possibly damaging Het
Acsm4 T C 7: 119,708,740 Y367H probably benign Het
Adam21 A T 12: 81,559,508 Y493* probably null Het
Add2 T C 6: 86,096,756 F209S probably damaging Het
Adgre4 T C 17: 55,791,497 S136P probably benign Het
Aff4 T G 11: 53,372,999 L282R probably damaging Het
Akt3 A G 1: 177,096,995 I178T probably damaging Het
Ap3m1 T C 14: 21,041,015 Y174C probably damaging Het
Atl1 A G 12: 69,953,500 E308G probably benign Het
Atp8b5 T G 4: 43,369,688 V942G probably damaging Het
B3gntl1 A G 11: 121,644,525 probably null Het
Btrc T G 19: 45,527,343 I480S probably damaging Het
Cacna1c A T 6: 118,630,322 I1366N probably benign Het
Ccdc113 T A 8: 95,540,831 N141K probably benign Het
Ccdc167 T C 17: 29,704,431 N77D possibly damaging Het
Ccser1 T C 6: 61,313,646 probably benign Het
Cenpe A G 3: 135,242,493 E1230G probably damaging Het
Clec12a A C 6: 129,350,481 T21P possibly damaging Het
Cyp26c1 T A 19: 37,687,377 F230I probably damaging Het
Exog A G 9: 119,452,266 E190G possibly damaging Het
Fam162b A G 10: 51,590,334 W30R probably benign Het
Fam172a C A 13: 77,902,720 H50N probably benign Het
Fndc3b G A 3: 27,456,451 Q841* probably null Het
Frzb T A 2: 80,424,601 Y197F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gabrb1 G A 5: 71,700,336 R43Q probably benign Het
Gm21060 A T 19: 61,297,007 H21Q possibly damaging Het
Gm4825 A G 15: 85,511,044 noncoding transcript Het
Gm5581 A C 6: 131,168,162 noncoding transcript Het
Gm9894 T C 13: 67,763,915 noncoding transcript Het
Gpr15 T A 16: 58,718,007 I240L probably benign Het
Gria4 A T 9: 4,519,546 probably benign Het
Grid2 T C 6: 63,908,893 L91S probably damaging Het
Igsf5 A C 16: 96,378,351 T215P probably damaging Het
Kif13a G A 13: 46,864,838 probably benign Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kifc2 T A 15: 76,662,825 L226H probably damaging Het
Klf10 T C 15: 38,295,996 H435R probably damaging Het
Masp1 T C 16: 23,452,932 Y623C probably damaging Het
Megf10 T A 18: 57,212,354 C118S probably damaging Het
Mical3 A G 6: 120,982,607 V909A possibly damaging Het
Mmrn2 A G 14: 34,398,475 probably null Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Nmi A T 2: 51,948,620 S301T probably benign Het
Nr2f2 G T 7: 70,358,155 T193K possibly damaging Het
Ntng2 T C 2: 29,197,098 N404S probably damaging Het
Olfr54 T G 11: 51,027,475 S158A probably benign Het
Olfr594 T C 7: 103,219,997 V93A probably benign Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Otoa T A 7: 121,118,569 D336E probably benign Het
Pde4b A G 4: 102,597,460 E108G probably damaging Het
Pdgfrb G A 18: 61,061,505 R118H possibly damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pla2g3 C T 11: 3,490,983 T316I probably benign Het
Plekhg4 A G 8: 105,381,464 E982G probably damaging Het
Pmfbp1 T G 8: 109,530,144 probably benign Het
Pot1b A T 17: 55,662,531 Y546N probably damaging Het
Rab11fip5 C A 6: 85,348,991 Q144H possibly damaging Het
Reep3 A T 10: 67,039,499 probably null Het
Rgl2 T C 17: 33,933,615 L400P probably damaging Het
Rnf122 A G 8: 31,124,846 probably benign Het
Scgb1b21 G T 7: 33,527,378 noncoding transcript Het
Sec63 A T 10: 42,823,886 K647N probably damaging Het
Sema4a C T 3: 88,438,176 probably benign Het
Serpinf1 C T 11: 75,416,419 V31I probably benign Het
Sez6l C T 5: 112,424,615 probably benign Het
Shank3 T C 15: 89,557,964 S1612P possibly damaging Het
Slc19a3 G A 1: 83,022,798 T166M probably benign Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc38a11 A T 2: 65,330,339 F304I possibly damaging Het
Slitrk1 T A 14: 108,912,190 N363I probably damaging Het
Slx4ip A G 2: 137,067,681 T129A probably benign Het
Spop T C 11: 95,491,711 V332A possibly damaging Het
Sptlc1 A C 13: 53,358,880 D147E probably benign Het
Tnpo1 T C 13: 98,852,932 Y754C probably damaging Het
Tox C A 4: 6,688,886 V493L probably damaging Het
Ttbk1 A C 17: 46,480,224 F45V probably damaging Het
Ttc27 T A 17: 74,780,856 M472K probably damaging Het
Ttll7 A G 3: 146,915,795 probably benign Het
Ttn A T 2: 76,721,760 C22851S probably benign Het
Ttn T A 2: 76,798,212 M14535L possibly damaging Het
Txlna T C 4: 129,640,262 T54A probably benign Het
Usp33 T C 3: 152,380,628 V668A probably damaging Het
Vmn2r28 C A 7: 5,481,071 C710F possibly damaging Het
Vmn2r8 T A 5: 108,798,095 M549L probably benign Het
Vwa5b2 T C 16: 20,602,191 probably null Het
Wnk1 T C 6: 119,969,247 I648M probably damaging Het
Other mutations in Kif27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Kif27 APN 13 58337604 missense probably benign
IGL00421:Kif27 APN 13 58343889 missense probably damaging 1.00
IGL00903:Kif27 APN 13 58344672 missense possibly damaging 0.69
IGL01024:Kif27 APN 13 58288201 missense possibly damaging 0.71
IGL01070:Kif27 APN 13 58344093 missense probably damaging 1.00
IGL01761:Kif27 APN 13 58337645 missense probably benign
IGL02160:Kif27 APN 13 58325998 missense probably damaging 1.00
IGL03162:Kif27 APN 13 58311207 missense probably benign 0.03
P0016:Kif27 UTSW 13 58303452 nonsense probably null
R0016:Kif27 UTSW 13 58354714 missense probably damaging 1.00
R0016:Kif27 UTSW 13 58354714 missense probably damaging 1.00
R0018:Kif27 UTSW 13 58288053 missense probably benign
R0018:Kif27 UTSW 13 58288053 missense probably benign
R0049:Kif27 UTSW 13 58303564 missense probably damaging 1.00
R0049:Kif27 UTSW 13 58303564 missense probably damaging 1.00
R0481:Kif27 UTSW 13 58311264 splice site probably benign
R0960:Kif27 UTSW 13 58323967 missense probably damaging 0.99
R1015:Kif27 UTSW 13 58320215 missense probably damaging 1.00
R1205:Kif27 UTSW 13 58344205 missense probably benign 0.00
R1478:Kif27 UTSW 13 58303545 missense probably damaging 0.98
R1789:Kif27 UTSW 13 58344008 missense probably damaging 1.00
R1959:Kif27 UTSW 13 58293123 missense probably benign 0.00
R3508:Kif27 UTSW 13 58313212 missense possibly damaging 0.88
R4168:Kif27 UTSW 13 58345748 missense probably benign 0.01
R4247:Kif27 UTSW 13 58287917 missense probably damaging 0.98
R4307:Kif27 UTSW 13 58344123 missense probably benign 0.00
R4621:Kif27 UTSW 13 58331013 missense probably benign 0.13
R4660:Kif27 UTSW 13 58323916 missense probably damaging 0.99
R4661:Kif27 UTSW 13 58323916 missense probably damaging 0.99
R4736:Kif27 UTSW 13 58328971 missense probably benign 0.04
R4770:Kif27 UTSW 13 58344377 missense probably damaging 1.00
R4853:Kif27 UTSW 13 58311258 missense probably benign 0.06
R4963:Kif27 UTSW 13 58328994 missense possibly damaging 0.85
R4998:Kif27 UTSW 13 58293143 missense probably damaging 0.98
R5134:Kif27 UTSW 13 58291090 missense possibly damaging 0.80
R5225:Kif27 UTSW 13 58293101 missense possibly damaging 0.88
R5835:Kif27 UTSW 13 58313146 critical splice donor site probably null
R5875:Kif27 UTSW 13 58311104 missense probably benign 0.01
R5929:Kif27 UTSW 13 58343970 missense probably benign 0.01
R6175:Kif27 UTSW 13 58311237 missense probably damaging 1.00
R6446:Kif27 UTSW 13 58345716 missense probably damaging 1.00
R6628:Kif27 UTSW 13 58354797 missense probably damaging 1.00
Z1088:Kif27 UTSW 13 58288033 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGTAAGCATTGACTGTGCAC -3'
(R):5'- CTTCATGTAGTCCAAGAAAACTGGG -3'

Sequencing Primer
(F):5'- CTGTGCACAGCAGAGTAGTGAC -3'
(R):5'- GTCCAAGAAAACTGGGCAATCTATTG -3'
Posted On2015-05-19