Incidental Mutation 'R1961:Abcc4'
ID317966
Institutional Source Beutler Lab
Gene Symbol Abcc4
Ensembl Gene ENSMUSG00000032849
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 4
SynonymsMRP4, D630049P08Rik, MOAT-B
MMRRC Submission 039975-MU
Accession Numbers

Genbank: NM_001033336.3, NM_001163675.1, NM_001163676.1; Ensembl: ENSMUST00000036554

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1961 (G1)
Quality Score108
Status Validated
Chromosome14
Chromosomal Location118482692-118706219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 118611456 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 495 (G495C)
Ref Sequence ENSEMBL: ENSMUSP00000129677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036554] [ENSMUST00000166646]
Predicted Effect probably damaging
Transcript: ENSMUST00000036554
AA Change: G570C

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042186
Gene: ENSMUSG00000032849
AA Change: G570C

DomainStartEndE-ValueType
Pfam:ABC_membrane 92 365 4.5e-37 PFAM
AAA 437 610 5.71e-12 SMART
Pfam:ABC_membrane 714 993 4.2e-47 PFAM
AAA 1067 1251 2.02e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166646
AA Change: G495C

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129677
Gene: ENSMUSG00000032849
AA Change: G495C

DomainStartEndE-ValueType
Pfam:ABC_membrane 98 290 4.1e-22 PFAM
AAA 362 535 5.71e-12 SMART
Pfam:ABC_membrane 638 922 4.6e-39 PFAM
AAA 992 1176 2.02e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228848
Meta Mutation Damage Score 0.0232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This family member plays a role in cellular detoxification as a pump for its substrate, organic anions. It may also function in prostaglandin-mediated cAMP signaling in ciliogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice are viable and fertile. Homozygotes for one null allele display impaired organic anion transport in the blood-brain and blood-cerebrospinal fluid barriers and kidney. Homozygotes for a second null allele display hypoalgesia and abnormal PGE2 physiology. [provided by MGI curators]
Allele List at MGI

All alleles(143) : Targeted, knock-out(2) Gene trapped(141)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,269 S265P possibly damaging Het
3110001I22Rik T A 16: 13,677,728 H230Q probably benign Het
Abcc1 T C 16: 14,396,393 Y191H probably damaging Het
Acsm4 T C 7: 119,708,740 Y367H probably benign Het
Adam21 A T 12: 81,559,508 Y493* probably null Het
Add2 T C 6: 86,096,756 F209S probably damaging Het
Adgre4 T C 17: 55,791,497 S136P probably benign Het
Aff4 T G 11: 53,372,999 L282R probably damaging Het
Akt3 A G 1: 177,096,995 I178T probably damaging Het
Ap3m1 T C 14: 21,041,015 Y174C probably damaging Het
Atl1 A G 12: 69,953,500 E308G probably benign Het
Atp8b5 T G 4: 43,369,688 V942G probably damaging Het
B3gntl1 A G 11: 121,644,525 probably null Het
Btrc T G 19: 45,527,343 I480S probably damaging Het
Cacna1c A T 6: 118,630,322 I1366N probably benign Het
Ccdc113 T A 8: 95,540,831 N141K probably benign Het
Ccdc167 T C 17: 29,704,431 N77D possibly damaging Het
Ccser1 T C 6: 61,313,646 probably benign Het
Cenpe A G 3: 135,242,493 E1230G probably damaging Het
Clec12a A C 6: 129,350,481 T21P possibly damaging Het
Cyp26c1 T A 19: 37,687,377 F230I probably damaging Het
Exog A G 9: 119,452,266 E190G possibly damaging Het
Fam162b A G 10: 51,590,334 W30R probably benign Het
Fam172a C A 13: 77,902,720 H50N probably benign Het
Fndc3b G A 3: 27,456,451 Q841* probably null Het
Frzb T A 2: 80,424,601 Y197F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gabrb1 G A 5: 71,700,336 R43Q probably benign Het
Gm21060 A T 19: 61,297,007 H21Q possibly damaging Het
Gm4825 A G 15: 85,511,044 noncoding transcript Het
Gm5581 A C 6: 131,168,162 noncoding transcript Het
Gm9894 T C 13: 67,763,915 noncoding transcript Het
Gpr15 T A 16: 58,718,007 I240L probably benign Het
Gria4 A T 9: 4,519,546 probably benign Het
Grid2 T C 6: 63,908,893 L91S probably damaging Het
Igsf5 A C 16: 96,378,351 T215P probably damaging Het
Kif13a G A 13: 46,864,838 probably benign Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kif27 T G 13: 58,293,123 R1159S probably benign Het
Kifc2 T A 15: 76,662,825 L226H probably damaging Het
Klf10 T C 15: 38,295,996 H435R probably damaging Het
Masp1 T C 16: 23,452,932 Y623C probably damaging Het
Megf10 T A 18: 57,212,354 C118S probably damaging Het
Mical3 A G 6: 120,982,607 V909A possibly damaging Het
Mmrn2 A G 14: 34,398,475 probably null Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Nmi A T 2: 51,948,620 S301T probably benign Het
Nr2f2 G T 7: 70,358,155 T193K possibly damaging Het
Ntng2 T C 2: 29,197,098 N404S probably damaging Het
Olfr54 T G 11: 51,027,475 S158A probably benign Het
Olfr594 T C 7: 103,219,997 V93A probably benign Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Otoa T A 7: 121,118,569 D336E probably benign Het
Pde4b A G 4: 102,597,460 E108G probably damaging Het
Pdgfrb G A 18: 61,061,505 R118H possibly damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pla2g3 C T 11: 3,490,983 T316I probably benign Het
Plekhg4 A G 8: 105,381,464 E982G probably damaging Het
Pmfbp1 T G 8: 109,530,144 probably benign Het
Pot1b A T 17: 55,662,531 Y546N probably damaging Het
Rab11fip5 C A 6: 85,348,991 Q144H possibly damaging Het
Reep3 A T 10: 67,039,499 probably null Het
Rgl2 T C 17: 33,933,615 L400P probably damaging Het
Rnf122 A G 8: 31,124,846 probably benign Het
Scgb1b21 G T 7: 33,527,378 noncoding transcript Het
Sec63 A T 10: 42,823,886 K647N probably damaging Het
Sema4a C T 3: 88,438,176 probably benign Het
Serpinf1 C T 11: 75,416,419 V31I probably benign Het
Sez6l C T 5: 112,424,615 probably benign Het
Shank3 T C 15: 89,557,964 S1612P possibly damaging Het
Slc19a3 G A 1: 83,022,798 T166M probably benign Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc38a11 A T 2: 65,330,339 F304I possibly damaging Het
Slitrk1 T A 14: 108,912,190 N363I probably damaging Het
Slx4ip A G 2: 137,067,681 T129A probably benign Het
Spop T C 11: 95,491,711 V332A possibly damaging Het
Sptlc1 A C 13: 53,358,880 D147E probably benign Het
Tnpo1 T C 13: 98,852,932 Y754C probably damaging Het
Tox C A 4: 6,688,886 V493L probably damaging Het
Ttbk1 A C 17: 46,480,224 F45V probably damaging Het
Ttc27 T A 17: 74,780,856 M472K probably damaging Het
Ttll7 A G 3: 146,915,795 probably benign Het
Ttn A T 2: 76,721,760 C22851S probably benign Het
Ttn T A 2: 76,798,212 M14535L possibly damaging Het
Txlna T C 4: 129,640,262 T54A probably benign Het
Usp33 T C 3: 152,380,628 V668A probably damaging Het
Vmn2r28 C A 7: 5,481,071 C710F possibly damaging Het
Vmn2r8 T A 5: 108,798,095 M549L probably benign Het
Vwa5b2 T C 16: 20,602,191 probably null Het
Wnk1 T C 6: 119,969,247 I648M probably damaging Het
Other mutations in Abcc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Abcc4 APN 14 118528997 missense probably benign 0.03
IGL01152:Abcc4 APN 14 118599385 missense probably damaging 1.00
IGL01511:Abcc4 APN 14 118599341 missense probably benign 0.03
IGL01604:Abcc4 APN 14 118527994 missense possibly damaging 0.94
IGL01725:Abcc4 APN 14 118500829 missense probably damaging 1.00
IGL01828:Abcc4 APN 14 118553279 splice site probably benign
IGL02174:Abcc4 APN 14 118500742 missense probably damaging 0.98
IGL02391:Abcc4 APN 14 118553352 missense probably damaging 1.00
IGL02500:Abcc4 APN 14 118618926 missense possibly damaging 0.47
IGL02598:Abcc4 APN 14 118668369 nonsense probably null
IGL02668:Abcc4 APN 14 118611475 missense probably damaging 1.00
IGL02708:Abcc4 APN 14 118500801 missense probably damaging 1.00
IGL02859:Abcc4 APN 14 118516500 missense probably damaging 1.00
IGL03249:Abcc4 APN 14 118627706 splice site probably benign
IGL03257:Abcc4 APN 14 118615211 missense probably benign 0.01
IGL03298:Abcc4 APN 14 118611468 missense probably damaging 1.00
1mM(1):Abcc4 UTSW 14 118629656 nonsense probably null
R0743:Abcc4 UTSW 14 118553288 missense possibly damaging 0.90
R0884:Abcc4 UTSW 14 118553288 missense possibly damaging 0.90
R1139:Abcc4 UTSW 14 118500840 missense possibly damaging 0.56
R1238:Abcc4 UTSW 14 118597639 splice site probably benign
R1588:Abcc4 UTSW 14 118534072 missense probably benign 0.01
R1678:Abcc4 UTSW 14 118594894 missense probably benign 0.08
R1785:Abcc4 UTSW 14 118553349 missense probably damaging 0.99
R1786:Abcc4 UTSW 14 118553349 missense probably damaging 0.99
R1961:Abcc4 UTSW 14 118611459 missense possibly damaging 0.92
R1993:Abcc4 UTSW 14 118526282 missense probably benign 0.02
R2025:Abcc4 UTSW 14 118553325 missense probably benign 0.13
R3613:Abcc4 UTSW 14 118627451 critical splice donor site probably null
R3864:Abcc4 UTSW 14 118616415 missense probably benign
R4274:Abcc4 UTSW 14 118629622 missense probably damaging 1.00
R4459:Abcc4 UTSW 14 118599393 missense probably benign 0.11
R4601:Abcc4 UTSW 14 118632163 missense probably benign 0.00
R4665:Abcc4 UTSW 14 118529002 missense probably benign
R4678:Abcc4 UTSW 14 118627691 missense probably damaging 0.97
R4771:Abcc4 UTSW 14 118484384 missense probably benign 0.00
R4962:Abcc4 UTSW 14 118668399 missense probably benign 0.33
R4997:Abcc4 UTSW 14 118516503 nonsense probably null
R5273:Abcc4 UTSW 14 118594821 missense possibly damaging 0.76
R5526:Abcc4 UTSW 14 118631037 missense probably benign 0.10
R5652:Abcc4 UTSW 14 118618927 missense probably benign 0.00
R5820:Abcc4 UTSW 14 118604195 missense probably benign 0.14
R5873:Abcc4 UTSW 14 118526290 missense probably benign 0.00
R6008:Abcc4 UTSW 14 118490566 missense possibly damaging 0.63
R6080:Abcc4 UTSW 14 118669050 missense possibly damaging 0.75
R6222:Abcc4 UTSW 14 118529956 missense probably damaging 1.00
R6919:Abcc4 UTSW 14 118594894 missense probably benign 0.08
R6931:Abcc4 UTSW 14 118527988 missense probably damaging 0.99
R7013:Abcc4 UTSW 14 118526343 missense probably benign
R7055:Abcc4 UTSW 14 118594785 nonsense probably null
R7146:Abcc4 UTSW 14 118615181 missense probably damaging 1.00
R7365:Abcc4 UTSW 14 118627654 missense probably damaging 1.00
R7402:Abcc4 UTSW 14 118706075 missense probably damaging 1.00
R7438:Abcc4 UTSW 14 118616446 missense probably benign 0.01
R7528:Abcc4 UTSW 14 118529905 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGACGTGCCTTCTGTTCTTAAAC -3'
(R):5'- GCCGCGGATACTTCAAATG -3'

Sequencing Primer
(F):5'- AAACTCTAACACTCGGGCTCTGTG -3'
(R):5'- TGAACACCCAGTTGCCATGAG -3'
Posted On2015-05-19