Incidental Mutation 'R1961:Masp1'
ID317977
Institutional Source Beutler Lab
Gene Symbol Masp1
Ensembl Gene ENSMUSG00000022887
Gene Namemannan-binding lectin serine peptidase 1
SynonymsCrarf
MMRRC Submission 039975-MU
Accession Numbers

Genbank: NM_008555; MGI: 88492

Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R1961 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location23449417-23520815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23452932 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 623 (Y623C)
Ref Sequence ENSEMBL: ENSMUSP00000087327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089883]
Predicted Effect probably damaging
Transcript: ENSMUST00000089883
AA Change: Y623C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087327
Gene: ENSMUSG00000022887
AA Change: Y623C

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
CUB 23 143 2.96e-36 SMART
EGF_CA 144 187 1.46e-7 SMART
CUB 190 302 1.49e-41 SMART
CCP 306 367 4.41e-12 SMART
CCP 372 437 3.05e-6 SMART
Tryp_SPc 453 696 4.66e-84 SMART
Meta Mutation Damage Score 0.406 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 99% (93/94)
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele display decreased survivor rate, reduced body weight, and impaired activation of the lectin and alternative complement pathways. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,269 S265P possibly damaging Het
3110001I22Rik T A 16: 13,677,728 H230Q probably benign Het
Abcc1 T C 16: 14,396,393 Y191H probably damaging Het
Abcc4 C A 14: 118,611,456 G495C probably damaging Het
Abcc4 C A 14: 118,611,459 V494L possibly damaging Het
Acsm4 T C 7: 119,708,740 Y367H probably benign Het
Adam21 A T 12: 81,559,508 Y493* probably null Het
Add2 T C 6: 86,096,756 F209S probably damaging Het
Adgre4 T C 17: 55,791,497 S136P probably benign Het
Aff4 T G 11: 53,372,999 L282R probably damaging Het
Akt3 A G 1: 177,096,995 I178T probably damaging Het
Ap3m1 T C 14: 21,041,015 Y174C probably damaging Het
Atl1 A G 12: 69,953,500 E308G probably benign Het
Atp8b5 T G 4: 43,369,688 V942G probably damaging Het
B3gntl1 A G 11: 121,644,525 probably null Het
Btrc T G 19: 45,527,343 I480S probably damaging Het
Cacna1c A T 6: 118,630,322 I1366N probably benign Het
Ccdc113 T A 8: 95,540,831 N141K probably benign Het
Ccdc167 T C 17: 29,704,431 N77D possibly damaging Het
Ccser1 T C 6: 61,313,646 probably benign Het
Cenpe A G 3: 135,242,493 E1230G probably damaging Het
Clec12a A C 6: 129,350,481 T21P possibly damaging Het
Cyp26c1 T A 19: 37,687,377 F230I probably damaging Het
Exog A G 9: 119,452,266 E190G possibly damaging Het
Fam162b A G 10: 51,590,334 W30R probably benign Het
Fam172a C A 13: 77,902,720 H50N probably benign Het
Fndc3b G A 3: 27,456,451 Q841* probably null Het
Frzb T A 2: 80,424,601 Y197F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gabrb1 G A 5: 71,700,336 R43Q probably benign Het
Gm21060 A T 19: 61,297,007 H21Q possibly damaging Het
Gm4825 A G 15: 85,511,044 noncoding transcript Het
Gm5581 A C 6: 131,168,162 noncoding transcript Het
Gm9894 T C 13: 67,763,915 noncoding transcript Het
Gpr15 T A 16: 58,718,007 I240L probably benign Het
Gria4 A T 9: 4,519,546 probably benign Het
Grid2 T C 6: 63,908,893 L91S probably damaging Het
Igsf5 A C 16: 96,378,351 T215P probably damaging Het
Kif13a G A 13: 46,864,838 probably benign Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kif27 T G 13: 58,293,123 R1159S probably benign Het
Kifc2 T A 15: 76,662,825 L226H probably damaging Het
Klf10 T C 15: 38,295,996 H435R probably damaging Het
Megf10 T A 18: 57,212,354 C118S probably damaging Het
Mical3 A G 6: 120,982,607 V909A possibly damaging Het
Mmrn2 A G 14: 34,398,475 probably null Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Nmi A T 2: 51,948,620 S301T probably benign Het
Nr2f2 G T 7: 70,358,155 T193K possibly damaging Het
Ntng2 T C 2: 29,197,098 N404S probably damaging Het
Olfr54 T G 11: 51,027,475 S158A probably benign Het
Olfr594 T C 7: 103,219,997 V93A probably benign Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Otoa T A 7: 121,118,569 D336E probably benign Het
Pde4b A G 4: 102,597,460 E108G probably damaging Het
Pdgfrb G A 18: 61,061,505 R118H possibly damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pla2g3 C T 11: 3,490,983 T316I probably benign Het
Plekhg4 A G 8: 105,381,464 E982G probably damaging Het
Pmfbp1 T G 8: 109,530,144 probably benign Het
Pot1b A T 17: 55,662,531 Y546N probably damaging Het
Rab11fip5 C A 6: 85,348,991 Q144H possibly damaging Het
Reep3 A T 10: 67,039,499 probably null Het
Rgl2 T C 17: 33,933,615 L400P probably damaging Het
Rnf122 A G 8: 31,124,846 probably benign Het
Scgb1b21 G T 7: 33,527,378 noncoding transcript Het
Sec63 A T 10: 42,823,886 K647N probably damaging Het
Sema4a C T 3: 88,438,176 probably benign Het
Serpinf1 C T 11: 75,416,419 V31I probably benign Het
Sez6l C T 5: 112,424,615 probably benign Het
Shank3 T C 15: 89,557,964 S1612P possibly damaging Het
Slc19a3 G A 1: 83,022,798 T166M probably benign Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc38a11 A T 2: 65,330,339 F304I possibly damaging Het
Slitrk1 T A 14: 108,912,190 N363I probably damaging Het
Slx4ip A G 2: 137,067,681 T129A probably benign Het
Spop T C 11: 95,491,711 V332A possibly damaging Het
Sptlc1 A C 13: 53,358,880 D147E probably benign Het
Tnpo1 T C 13: 98,852,932 Y754C probably damaging Het
Tox C A 4: 6,688,886 V493L probably damaging Het
Ttbk1 A C 17: 46,480,224 F45V probably damaging Het
Ttc27 T A 17: 74,780,856 M472K probably damaging Het
Ttll7 A G 3: 146,915,795 probably benign Het
Ttn A T 2: 76,721,760 C22851S probably benign Het
Ttn T A 2: 76,798,212 M14535L possibly damaging Het
Txlna T C 4: 129,640,262 T54A probably benign Het
Usp33 T C 3: 152,380,628 V668A probably damaging Het
Vmn2r28 C A 7: 5,481,071 C710F possibly damaging Het
Vmn2r8 T A 5: 108,798,095 M549L probably benign Het
Vwa5b2 T C 16: 20,602,191 probably null Het
Wnk1 T C 6: 119,969,247 I648M probably damaging Het
Other mutations in Masp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Masp1 APN 16 23458091 missense possibly damaging 0.93
IGL00428:Masp1 APN 16 23476312 missense probably damaging 1.00
IGL00432:Masp1 APN 16 23513851 missense probably damaging 1.00
IGL02598:Masp1 APN 16 23459631 missense probably benign
IGL02718:Masp1 APN 16 23476293 missense probably damaging 1.00
IGL02947:Masp1 APN 16 23494726 missense probably damaging 0.99
A4554:Masp1 UTSW 16 23454940 splice site probably null
PIT1430001:Masp1 UTSW 16 23513944 missense probably damaging 1.00
R0103:Masp1 UTSW 16 23458018 missense probably damaging 1.00
R0505:Masp1 UTSW 16 23458138 missense probably benign
R0630:Masp1 UTSW 16 23452419 missense probably benign 0.01
R1146:Masp1 UTSW 16 23492115 missense probably damaging 1.00
R1146:Masp1 UTSW 16 23492115 missense probably damaging 1.00
R1339:Masp1 UTSW 16 23452467 missense probably damaging 1.00
R1521:Masp1 UTSW 16 23494637 missense probably damaging 1.00
R1588:Masp1 UTSW 16 23494654 missense probably damaging 1.00
R1986:Masp1 UTSW 16 23483461 missense probably benign 0.01
R2080:Masp1 UTSW 16 23491959 missense probably damaging 1.00
R2215:Masp1 UTSW 16 23452521 missense possibly damaging 0.92
R2216:Masp1 UTSW 16 23492055 missense probably benign 0.00
R2443:Masp1 UTSW 16 23476312 missense probably damaging 1.00
R4934:Masp1 UTSW 16 23465076 missense probably damaging 0.98
R5224:Masp1 UTSW 16 23494695 missense probably damaging 1.00
R5340:Masp1 UTSW 16 23458108 missense probably damaging 1.00
R5562:Masp1 UTSW 16 23465167 unclassified probably null
R5663:Masp1 UTSW 16 23452938 missense possibly damaging 0.57
R5742:Masp1 UTSW 16 23454925 missense probably benign 0.01
R5763:Masp1 UTSW 16 23496247 missense probably damaging 1.00
R5898:Masp1 UTSW 16 23491927 missense probably damaging 0.99
R6901:Masp1 UTSW 16 23513834 missense probably damaging 0.99
R6987:Masp1 UTSW 16 23513915 missense probably damaging 1.00
R7069:Masp1 UTSW 16 23452455 missense probably benign 0.20
R7356:Masp1 UTSW 16 23470243 missense possibly damaging 0.50
X0065:Masp1 UTSW 16 23513969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGAAAGGGCTGGTTCAG -3'
(R):5'- CACGGTGTTTCTATATGCTGTC -3'

Sequencing Primer
(F):5'- GGATGGCAAAAGTTCTATATTCCCCC -3'
(R):5'- AAAGCTGCTTTACCAGGGTC -3'
Posted On2015-05-19