Incidental Mutation 'R1960:Arid1a'
ID318018
Institutional Source Beutler Lab
Gene Symbol Arid1a
Ensembl Gene ENSMUSG00000007880
Gene NameAT rich interactive domain 1A (SWI-like)
Synonyms1110030E03Rik, Smarcf1, BAF250a, Osa1
MMRRC Submission 039974-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1960 (G1)
Quality Score109
Status Not validated
Chromosome4
Chromosomal Location133679008-133756769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 133753090 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 174 (H174Q)
Ref Sequence ENSEMBL: ENSMUSP00000122354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008024] [ENSMUST00000105897] [ENSMUST00000145664]
Predicted Effect probably benign
Transcript: ENSMUST00000008024
SMART Domains Protein: ENSMUSP00000008024
Gene: ENSMUSG00000007880

DomainStartEndE-ValueType
low complexity region 17 42 N/A INTRINSIC
low complexity region 86 110 N/A INTRINSIC
low complexity region 113 211 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 274 290 N/A INTRINSIC
low complexity region 310 323 N/A INTRINSIC
internal_repeat_3 329 402 4.13e-5 PROSPERO
low complexity region 410 426 N/A INTRINSIC
low complexity region 429 442 N/A INTRINSIC
internal_repeat_1 443 563 4.59e-6 PROSPERO
internal_repeat_2 461 595 1.38e-5 PROSPERO
low complexity region 604 626 N/A INTRINSIC
ARID 630 720 3.56e-25 SMART
BRIGHT 634 725 3.76e-31 SMART
low complexity region 739 751 N/A INTRINSIC
low complexity region 756 770 N/A INTRINSIC
internal_repeat_3 778 872 4.13e-5 PROSPERO
internal_repeat_2 781 928 1.38e-5 PROSPERO
internal_repeat_1 825 940 4.59e-6 PROSPERO
low complexity region 962 987 N/A INTRINSIC
low complexity region 1014 1045 N/A INTRINSIC
low complexity region 1187 1200 N/A INTRINSIC
low complexity region 1380 1404 N/A INTRINSIC
low complexity region 1500 1518 N/A INTRINSIC
Pfam:DUF3518 1592 1848 1.8e-146 PFAM
low complexity region 1849 1859 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105897
AA Change: H174Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101517
Gene: ENSMUSG00000007880
AA Change: H174Q

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 24 52 N/A INTRINSIC
low complexity region 74 96 N/A INTRINSIC
low complexity region 118 148 N/A INTRINSIC
low complexity region 161 169 N/A INTRINSIC
low complexity region 233 266 N/A INTRINSIC
low complexity region 273 295 N/A INTRINSIC
low complexity region 308 332 N/A INTRINSIC
low complexity region 367 373 N/A INTRINSIC
low complexity region 402 427 N/A INTRINSIC
low complexity region 471 495 N/A INTRINSIC
low complexity region 498 596 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
low complexity region 795 811 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
internal_repeat_2 828 948 9.26e-7 PROSPERO
internal_repeat_1 831 980 9.26e-7 PROSPERO
low complexity region 989 1011 N/A INTRINSIC
ARID 1015 1105 3.56e-25 SMART
BRIGHT 1019 1110 3.76e-31 SMART
low complexity region 1124 1136 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
internal_repeat_1 1159 1314 9.26e-7 PROSPERO
internal_repeat_2 1211 1326 9.26e-7 PROSPERO
low complexity region 1343 1368 N/A INTRINSIC
low complexity region 1395 1426 N/A INTRINSIC
low complexity region 1568 1581 N/A INTRINSIC
low complexity region 1761 1785 N/A INTRINSIC
low complexity region 1881 1899 N/A INTRINSIC
Pfam:DUF3518 1973 2229 1.4e-146 PFAM
low complexity region 2230 2240 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138473
Predicted Effect possibly damaging
Transcript: ENSMUST00000145664
AA Change: H174Q

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122354
Gene: ENSMUSG00000007880
AA Change: H174Q

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 24 52 N/A INTRINSIC
low complexity region 74 96 N/A INTRINSIC
low complexity region 118 148 N/A INTRINSIC
low complexity region 161 169 N/A INTRINSIC
low complexity region 233 266 N/A INTRINSIC
low complexity region 273 295 N/A INTRINSIC
low complexity region 308 332 N/A INTRINSIC
low complexity region 367 373 N/A INTRINSIC
low complexity region 402 427 N/A INTRINSIC
low complexity region 471 495 N/A INTRINSIC
low complexity region 498 596 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
internal_repeat_3 714 787 9.49e-6 PROSPERO
low complexity region 795 811 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
internal_repeat_1 828 948 8.73e-7 PROSPERO
internal_repeat_2 846 980 2.88e-6 PROSPERO
low complexity region 989 1011 N/A INTRINSIC
ARID 1015 1105 3.56e-25 SMART
BRIGHT 1019 1110 3.76e-31 SMART
low complexity region 1124 1136 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
internal_repeat_3 1163 1257 9.49e-6 PROSPERO
internal_repeat_2 1166 1313 2.88e-6 PROSPERO
internal_repeat_1 1210 1325 8.73e-7 PROSPERO
low complexity region 1347 1372 N/A INTRINSIC
low complexity region 1399 1430 N/A INTRINSIC
low complexity region 1572 1585 N/A INTRINSIC
low complexity region 1765 1789 N/A INTRINSIC
low complexity region 1885 1903 N/A INTRINSIC
Pfam:DUF3518 1978 2233 1.3e-117 PFAM
low complexity region 2234 2244 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family, whose members have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. It possesses at least two conserved domains that could be important for its function. First, it has a DNA-binding domain that can specifically bind an AT-rich DNA sequence known to be recognized by a SNF/SWI complex at the beta-globin locus. Second, the C-terminus of the protein can stimulate glucocorticoid receptor-dependent transcriptional activation. It is thought that the protein encoded by this gene confers specificity to the SNF/SWI complex and may recruit the complex to its targets through either protein-DNA or protein-protein interactions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos with homozygous null alleles arrest development at E6.5 with failure to form a mesoderm layer. Mice homozygous for an allele lacking exon 2 and 3 die shortly after birth and exhibit an increase in the hematopoietic stem cell population of the fetal liver at E14.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik C T 3: 145,938,221 P55S probably damaging Het
Adgre4 T C 17: 55,791,497 S136P probably benign Het
Als2cr12 A T 1: 58,659,278 V327D possibly damaging Het
Arap1 C A 7: 101,373,015 A8E probably damaging Het
Btbd2 A G 10: 80,644,705 I358T probably benign Het
Camkk2 G A 5: 122,737,512 R492* probably null Het
Capn3 T C 2: 120,463,940 V23A probably benign Het
Carm1 T G 9: 21,580,310 V225G probably benign Het
Ccdc113 T A 8: 95,540,831 N141K probably benign Het
Ccdc60 C A 5: 116,146,184 M298I probably benign Het
Celsr3 C T 9: 108,845,817 P2801L probably benign Het
Clec4n T A 6: 123,230,546 V23E probably damaging Het
Cmtr2 T G 8: 110,221,750 L231V probably damaging Het
Csrnp3 T G 2: 66,023,019 V585G probably null Het
Ctnnd2 T C 15: 30,647,111 S318P probably damaging Het
Cubn A T 2: 13,340,017 probably null Het
Dgkd C A 1: 87,929,827 P754T possibly damaging Het
Dnah7a A G 1: 53,684,983 S108P probably benign Het
Dnajc24 A G 2: 106,001,923 probably benign Het
Dner A T 1: 84,445,456 S475R probably damaging Het
Doxl2 C T 6: 48,975,753 T204I probably damaging Het
Dtnb T C 12: 3,781,190 L630P probably benign Het
Dysf T C 6: 84,073,903 F411L probably benign Het
Fam208a T C 14: 27,438,664 S128P probably damaging Het
Fam208a C T 14: 27,479,789 H1419Y possibly damaging Het
Fbxo18 G A 2: 11,757,528 A566V probably damaging Het
Fbxw19 G T 9: 109,485,936 T186K probably benign Het
Gm4825 A G 15: 85,511,044 noncoding transcript Het
Grhl2 T A 15: 37,336,314 V54D probably damaging Het
Hmcn1 T C 1: 150,675,991 I2621V probably benign Het
Hmcn1 T A 1: 150,677,376 E2521V possibly damaging Het
Kcng1 A G 2: 168,262,984 V314A probably benign Het
Kif13a G A 13: 46,864,838 probably benign Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kifc1 A G 17: 33,884,587 probably null Het
Klk13 T A 7: 43,721,007 N31K possibly damaging Het
Klri1 T A 6: 129,697,384 H221L probably benign Het
Ltbp4 G A 7: 27,329,018 P273L unknown Het
Med16 T C 10: 79,907,095 H14R possibly damaging Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Mrgpra2a T A 7: 47,427,235 I92F probably benign Het
Muc5b T C 7: 141,862,637 C3107R possibly damaging Het
Myo5a T A 9: 75,147,857 F441I probably damaging Het
Ndst4 T A 3: 125,438,682 L300* probably null Het
Nlgn2 G T 11: 69,827,310 D356E probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Oas1f G A 5: 120,856,439 C341Y possibly damaging Het
Olfm5 A T 7: 104,160,412 C111S possibly damaging Het
Olfr1176 T C 2: 88,340,201 L212P probably damaging Het
Olfr523 A T 7: 140,176,683 I188L probably benign Het
Olfr697 T C 7: 106,741,394 E180G probably damaging Het
Olfr821 C T 10: 130,034,318 Q231* probably null Het
Olfr876 A G 9: 37,803,946 I12V probably benign Het
Olfr919 T A 9: 38,698,204 H58L probably benign Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Pde10a T C 17: 8,942,918 I477T possibly damaging Het
Pde4b A G 4: 102,597,460 E108G probably damaging Het
Pdgfrb A T 18: 61,065,783 T338S probably benign Het
Pgghg A G 7: 140,943,347 M180V probably benign Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pot1b A T 17: 55,662,531 Y546N probably damaging Het
Rangap1 T C 15: 81,706,503 T463A probably benign Het
Rap1gds1 T C 3: 139,050,556 I13V probably null Het
Rbak A T 5: 143,174,682 Y205* probably null Het
Reg3b A T 6: 78,371,814 K31M probably damaging Het
Rfpl4 A T 7: 5,115,534 Y12* probably null Het
Rnase6 A G 14: 51,130,432 N94D possibly damaging Het
Rtn4 T C 11: 29,736,464 L273P probably damaging Het
Ryr3 A C 2: 112,794,467 F2203V probably damaging Het
Sae1 A T 7: 16,368,565 D161E possibly damaging Het
Sema5a T C 15: 32,562,731 F296S possibly damaging Het
Sh3rf1 C A 8: 61,384,863 P814Q probably damaging Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc25a25 C T 2: 32,420,651 probably null Het
Slco4c1 T A 1: 96,867,929 M135L probably benign Het
Slfn1 A G 11: 83,121,753 I232V possibly damaging Het
Slitrk1 T A 14: 108,912,190 N363I probably damaging Het
Srr A G 11: 74,908,716 V311A probably damaging Het
Tenm1 T C X: 42,827,201 D402G probably benign Het
Topors T C 4: 40,261,044 R747G unknown Het
Trank1 A T 9: 111,391,628 I2478F probably damaging Het
Trim69 A G 2: 122,167,684 N46D probably benign Het
Trpm1 T A 7: 64,230,230 L661Q probably damaging Het
Ttbk1 A C 17: 46,480,224 F45V probably damaging Het
Ttn T C 2: 76,814,305 K4708R probably damaging Het
Unkl A G 17: 25,209,645 probably benign Het
Uros A T 7: 133,687,006 N257K probably benign Het
Usp25 A G 16: 77,076,371 Y439C probably damaging Het
Vgf A G 5: 137,032,175 probably benign Het
Vmn2r8 A T 5: 108,799,286 D533E probably damaging Het
Vps13a A T 19: 16,725,631 Y653N probably damaging Het
Zfp358 T C 8: 3,495,742 V135A possibly damaging Het
Other mutations in Arid1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Arid1a APN 4 133685482 missense unknown
IGL01139:Arid1a APN 4 133693997 missense unknown
IGL01392:Arid1a APN 4 133681037 missense unknown
IGL01543:Arid1a APN 4 133681722 missense unknown
IGL01642:Arid1a APN 4 133681844 missense unknown
IGL01843:Arid1a APN 4 133681454 missense unknown
IGL02108:Arid1a APN 4 133680516 missense unknown
IGL02117:Arid1a APN 4 133692815 missense unknown
IGL02150:Arid1a APN 4 133687257 missense unknown
IGL02478:Arid1a APN 4 133681274 missense unknown
IGL02544:Arid1a APN 4 133681748 missense unknown
IGL03070:Arid1a APN 4 133694753 missense unknown
PIT4520001:Arid1a UTSW 4 133681916 missense unknown
R0023:Arid1a UTSW 4 133691176 missense unknown
R0023:Arid1a UTSW 4 133691176 missense unknown
R0419:Arid1a UTSW 4 133681124 missense unknown
R0452:Arid1a UTSW 4 133689105 missense unknown
R0631:Arid1a UTSW 4 133689170 missense unknown
R0648:Arid1a UTSW 4 133685204 missense unknown
R1004:Arid1a UTSW 4 133687275 missense unknown
R1225:Arid1a UTSW 4 133687365 missense unknown
R1229:Arid1a UTSW 4 133691237 missense unknown
R1435:Arid1a UTSW 4 133680698 missense unknown
R1480:Arid1a UTSW 4 133680389 missense unknown
R1491:Arid1a UTSW 4 133720926 missense unknown
R1674:Arid1a UTSW 4 133689260 missense unknown
R1909:Arid1a UTSW 4 133693761 missense unknown
R2018:Arid1a UTSW 4 133681834 missense unknown
R2147:Arid1a UTSW 4 133681366 missense unknown
R2303:Arid1a UTSW 4 133687251 missense unknown
R2320:Arid1a UTSW 4 133680529 missense unknown
R3775:Arid1a UTSW 4 133686764 missense unknown
R3907:Arid1a UTSW 4 133692912 splice site probably benign
R4509:Arid1a UTSW 4 133695699 intron probably benign
R4510:Arid1a UTSW 4 133695699 intron probably benign
R4551:Arid1a UTSW 4 133695699 intron probably benign
R4552:Arid1a UTSW 4 133695699 intron probably benign
R4606:Arid1a UTSW 4 133687323 missense unknown
R4745:Arid1a UTSW 4 133753106 missense probably benign 0.33
R4851:Arid1a UTSW 4 133681361 missense unknown
R4867:Arid1a UTSW 4 133720857 missense probably benign 0.01
R5203:Arid1a UTSW 4 133682003 missense unknown
R5227:Arid1a UTSW 4 133680405 missense unknown
R5294:Arid1a UTSW 4 133691055 splice site probably benign
R5299:Arid1a UTSW 4 133687226 missense unknown
R5412:Arid1a UTSW 4 133719602 unclassified probably benign
R5540:Arid1a UTSW 4 133680454 missense unknown
R5704:Arid1a UTSW 4 133681739 missense unknown
R5870:Arid1a UTSW 4 133681076 missense unknown
R6092:Arid1a UTSW 4 133693852 missense unknown
R6151:Arid1a UTSW 4 133684976 missense unknown
R6240:Arid1a UTSW 4 133680686 missense unknown
R6379:Arid1a UTSW 4 133680927 missense unknown
R6427:Arid1a UTSW 4 133681524 missense unknown
R6739:Arid1a UTSW 4 133687626 missense unknown
X0064:Arid1a UTSW 4 133689260 missense unknown
Predicted Primers PCR Primer
(F):5'- CGACGTGAGCAGTTGGTTGA -3'
(R):5'- TAGGCCCGCCCTGAACAATA -3'

Sequencing Primer
(F):5'- ACCTCTCGGGGAGCTCAG -3'
(R):5'- ATAACCTCCCGGAGCCG -3'
Posted On2015-05-19