Incidental Mutation 'R1960:Rbak'
ID318025
Institutional Source Beutler Lab
Gene Symbol Rbak
Ensembl Gene ENSMUSG00000061898
Gene NameRB-associated KRAB zinc finger
Synonyms
MMRRC Submission 039974-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock #R1960 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location143172186-143180775 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 143174682 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 205 (Y205*)
Ref Sequence ENSEMBL: ENSMUSP00000128731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049861] [ENSMUST00000165318]
Predicted Effect probably null
Transcript: ENSMUST00000049861
AA Change: Y205*
SMART Domains Protein: ENSMUSP00000059273
Gene: ENSMUSG00000061898
AA Change: Y205*

DomainStartEndE-ValueType
KRAB 8 68 6.89e-36 SMART
ZnF_C2H2 258 280 1.1e-2 SMART
ZnF_C2H2 286 308 1.4e-4 SMART
ZnF_C2H2 314 336 5.21e-4 SMART
ZnF_C2H2 342 364 1.95e-3 SMART
ZnF_C2H2 370 392 2.3e-5 SMART
ZnF_C2H2 398 420 3.95e-4 SMART
ZnF_C2H2 426 448 5.59e-4 SMART
ZnF_C2H2 454 476 1.12e-3 SMART
ZnF_C2H2 508 528 1.4e1 SMART
ZnF_C2H2 536 558 3.89e-3 SMART
ZnF_C2H2 564 586 1.04e-3 SMART
ZnF_C2H2 592 614 5.42e-2 SMART
ZnF_C2H2 620 642 1.5e-4 SMART
ZnF_C2H2 648 670 9.22e-5 SMART
ZnF_C2H2 676 698 5.21e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000165318
AA Change: Y205*
SMART Domains Protein: ENSMUSP00000128731
Gene: ENSMUSG00000061898
AA Change: Y205*

DomainStartEndE-ValueType
KRAB 8 68 6.89e-36 SMART
ZnF_C2H2 258 280 1.1e-2 SMART
ZnF_C2H2 286 308 1.4e-4 SMART
ZnF_C2H2 314 336 5.21e-4 SMART
ZnF_C2H2 342 364 1.95e-3 SMART
ZnF_C2H2 370 392 2.3e-5 SMART
ZnF_C2H2 398 420 3.95e-4 SMART
ZnF_C2H2 426 448 5.59e-4 SMART
ZnF_C2H2 454 476 1.12e-3 SMART
ZnF_C2H2 508 528 1.4e1 SMART
ZnF_C2H2 536 558 3.89e-3 SMART
ZnF_C2H2 564 586 1.04e-3 SMART
ZnF_C2H2 592 614 5.42e-2 SMART
ZnF_C2H2 620 642 1.5e-4 SMART
ZnF_C2H2 648 670 9.22e-5 SMART
ZnF_C2H2 676 698 5.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166382
SMART Domains Protein: ENSMUSP00000132239
Gene: ENSMUSG00000061898

DomainStartEndE-ValueType
KRAB 27 87 6.89e-36 SMART
ZnF_C2H2 277 299 1.1e-2 SMART
ZnF_C2H2 305 327 1.4e-4 SMART
ZnF_C2H2 333 355 5.21e-4 SMART
ZnF_C2H2 361 383 1.95e-3 SMART
ZnF_C2H2 389 411 2.3e-5 SMART
ZnF_C2H2 417 439 3.95e-4 SMART
ZnF_C2H2 445 467 5.59e-4 SMART
ZnF_C2H2 473 495 1.12e-3 SMART
ZnF_C2H2 527 547 1.4e1 SMART
ZnF_C2H2 555 577 3.89e-3 SMART
ZnF_C2H2 583 605 1.04e-3 SMART
ZnF_C2H2 611 633 5.42e-2 SMART
ZnF_C2H2 639 661 1.5e-4 SMART
ZnF_C2H2 667 689 9.22e-5 SMART
ZnF_C2H2 695 717 5.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199880
Meta Mutation Damage Score 0.634 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein which interacts with the tumor suppressor retinoblastoma 1. The two interacting proteins are thought to act as a transcriptional repressor for promoters which are activated by the E2F1 transcription factor. This protein contains a Kruppel-associated box (KRAB), which is a transcriptional repressor motif. Read-through transcripts that include exons from the downstream gene LOC389458 are expressed from this locus. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik C T 3: 145,938,221 P55S probably damaging Het
Adgre4 T C 17: 55,791,497 S136P probably benign Het
Als2cr12 A T 1: 58,659,278 V327D possibly damaging Het
Arap1 C A 7: 101,373,015 A8E probably damaging Het
Arid1a A T 4: 133,753,090 H174Q possibly damaging Het
Btbd2 A G 10: 80,644,705 I358T probably benign Het
Camkk2 G A 5: 122,737,512 R492* probably null Het
Capn3 T C 2: 120,463,940 V23A probably benign Het
Carm1 T G 9: 21,580,310 V225G probably benign Het
Ccdc113 T A 8: 95,540,831 N141K probably benign Het
Ccdc60 C A 5: 116,146,184 M298I probably benign Het
Celsr3 C T 9: 108,845,817 P2801L probably benign Het
Clec4n T A 6: 123,230,546 V23E probably damaging Het
Cmtr2 T G 8: 110,221,750 L231V probably damaging Het
Csrnp3 T G 2: 66,023,019 V585G probably null Het
Ctnnd2 T C 15: 30,647,111 S318P probably damaging Het
Cubn A T 2: 13,340,017 probably null Het
Dgkd C A 1: 87,929,827 P754T possibly damaging Het
Dnah7a A G 1: 53,684,983 S108P probably benign Het
Dnajc24 A G 2: 106,001,923 probably benign Het
Dner A T 1: 84,445,456 S475R probably damaging Het
Doxl2 C T 6: 48,975,753 T204I probably damaging Het
Dtnb T C 12: 3,781,190 L630P probably benign Het
Dysf T C 6: 84,073,903 F411L probably benign Het
Fam208a T C 14: 27,438,664 S128P probably damaging Het
Fam208a C T 14: 27,479,789 H1419Y possibly damaging Het
Fbxo18 G A 2: 11,757,528 A566V probably damaging Het
Fbxw19 G T 9: 109,485,936 T186K probably benign Het
Gm4825 A G 15: 85,511,044 noncoding transcript Het
Grhl2 T A 15: 37,336,314 V54D probably damaging Het
Hmcn1 T C 1: 150,675,991 I2621V probably benign Het
Hmcn1 T A 1: 150,677,376 E2521V possibly damaging Het
Kcng1 A G 2: 168,262,984 V314A probably benign Het
Kif13a G A 13: 46,864,838 probably benign Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kifc1 A G 17: 33,884,587 probably null Het
Klk13 T A 7: 43,721,007 N31K possibly damaging Het
Klri1 T A 6: 129,697,384 H221L probably benign Het
Ltbp4 G A 7: 27,329,018 P273L unknown Het
Med16 T C 10: 79,907,095 H14R possibly damaging Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Mrgpra2a T A 7: 47,427,235 I92F probably benign Het
Muc5b T C 7: 141,862,637 C3107R possibly damaging Het
Myo5a T A 9: 75,147,857 F441I probably damaging Het
Ndst4 T A 3: 125,438,682 L300* probably null Het
Nlgn2 G T 11: 69,827,310 D356E probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Oas1f G A 5: 120,856,439 C341Y possibly damaging Het
Olfm5 A T 7: 104,160,412 C111S possibly damaging Het
Olfr1176 T C 2: 88,340,201 L212P probably damaging Het
Olfr523 A T 7: 140,176,683 I188L probably benign Het
Olfr697 T C 7: 106,741,394 E180G probably damaging Het
Olfr821 C T 10: 130,034,318 Q231* probably null Het
Olfr876 A G 9: 37,803,946 I12V probably benign Het
Olfr919 T A 9: 38,698,204 H58L probably benign Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Pde10a T C 17: 8,942,918 I477T possibly damaging Het
Pde4b A G 4: 102,597,460 E108G probably damaging Het
Pdgfrb A T 18: 61,065,783 T338S probably benign Het
Pgghg A G 7: 140,943,347 M180V probably benign Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pot1b A T 17: 55,662,531 Y546N probably damaging Het
Rangap1 T C 15: 81,706,503 T463A probably benign Het
Rap1gds1 T C 3: 139,050,556 I13V probably null Het
Reg3b A T 6: 78,371,814 K31M probably damaging Het
Rfpl4 A T 7: 5,115,534 Y12* probably null Het
Rnase6 A G 14: 51,130,432 N94D possibly damaging Het
Rtn4 T C 11: 29,736,464 L273P probably damaging Het
Ryr3 A C 2: 112,794,467 F2203V probably damaging Het
Sae1 A T 7: 16,368,565 D161E possibly damaging Het
Sema5a T C 15: 32,562,731 F296S possibly damaging Het
Sh3rf1 C A 8: 61,384,863 P814Q probably damaging Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc25a25 C T 2: 32,420,651 probably null Het
Slco4c1 T A 1: 96,867,929 M135L probably benign Het
Slfn1 A G 11: 83,121,753 I232V possibly damaging Het
Slitrk1 T A 14: 108,912,190 N363I probably damaging Het
Srr A G 11: 74,908,716 V311A probably damaging Het
Tenm1 T C X: 42,827,201 D402G probably benign Het
Topors T C 4: 40,261,044 R747G unknown Het
Trank1 A T 9: 111,391,628 I2478F probably damaging Het
Trim69 A G 2: 122,167,684 N46D probably benign Het
Trpm1 T A 7: 64,230,230 L661Q probably damaging Het
Ttbk1 A C 17: 46,480,224 F45V probably damaging Het
Ttn T C 2: 76,814,305 K4708R probably damaging Het
Unkl A G 17: 25,209,645 probably benign Het
Uros A T 7: 133,687,006 N257K probably benign Het
Usp25 A G 16: 77,076,371 Y439C probably damaging Het
Vgf A G 5: 137,032,175 probably benign Het
Vmn2r8 A T 5: 108,799,286 D533E probably damaging Het
Vps13a A T 19: 16,725,631 Y653N probably damaging Het
Zfp358 T C 8: 3,495,742 V135A possibly damaging Het
Other mutations in Rbak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Rbak APN 5 143176600 splice site probably benign
R0117:Rbak UTSW 5 143173632 nonsense probably null
R0514:Rbak UTSW 5 143173414 missense probably damaging 0.96
R0945:Rbak UTSW 5 143173579 missense probably damaging 1.00
R1483:Rbak UTSW 5 143174344 missense probably damaging 1.00
R1796:Rbak UTSW 5 143173447 missense probably damaging 1.00
R1916:Rbak UTSW 5 143176116 missense probably damaging 1.00
R2039:Rbak UTSW 5 143173175 missense probably benign 0.37
R2070:Rbak UTSW 5 143176584 missense probably damaging 0.99
R2071:Rbak UTSW 5 143176584 missense probably damaging 0.99
R2151:Rbak UTSW 5 143176502 missense possibly damaging 0.65
R2877:Rbak UTSW 5 143174105 missense probably damaging 1.00
R4030:Rbak UTSW 5 143173969 missense probably damaging 1.00
R4584:Rbak UTSW 5 143176123 missense probably benign 0.00
R4612:Rbak UTSW 5 143174467 missense probably benign 0.01
R5229:Rbak UTSW 5 143174162 missense probably damaging 1.00
R5518:Rbak UTSW 5 143173309 missense probably damaging 1.00
R5541:Rbak UTSW 5 143173990 missense probably damaging 1.00
R5873:Rbak UTSW 5 143173711 missense probably benign 0.32
R5908:Rbak UTSW 5 143173636 missense probably damaging 1.00
R6053:Rbak UTSW 5 143174682 nonsense probably null
R6416:Rbak UTSW 5 143176552 missense possibly damaging 0.67
R6693:Rbak UTSW 5 143174111 missense probably damaging 0.97
R7041:Rbak UTSW 5 143173471 missense probably damaging 1.00
R7057:Rbak UTSW 5 143173927 missense possibly damaging 0.81
R7341:Rbak UTSW 5 143176072 missense probably benign 0.01
R7454:Rbak UTSW 5 143173773 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAAAGCAGAGTTTAGATTGAAGGT -3'
(R):5'- TGATTAGCAGTGACGGAAGC -3'

Sequencing Primer
(F):5'- AAGTGCGATCTCCGATGTAC -3'
(R):5'- AGCTATGCACTGGAGAAGCCC -3'
Posted On2015-05-19