Incidental Mutation 'R1960:Myo5a'
ID318052
Institutional Source Beutler Lab
Gene Symbol Myo5a
Ensembl Gene ENSMUSG00000034593
Gene Namemyosin VA
Synonyms9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA
MMRRC Submission 039974-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R1960 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location75071015-75223688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75147857 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 441 (F441I)
Ref Sequence ENSEMBL: ENSMUSP00000117493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000123531] [ENSMUST00000136731] [ENSMUST00000155282]
Predicted Effect probably damaging
Transcript: ENSMUST00000123128
AA Change: F441I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: F441I

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
DIL 1685 1790 2.47e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123531
Predicted Effect probably damaging
Transcript: ENSMUST00000136731
AA Change: F441I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: F441I

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1418 N/A INTRINSIC
DIL 1660 1765 2.47e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142181
Predicted Effect probably damaging
Transcript: ENSMUST00000155282
AA Change: F441I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: F441I

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1339 1445 N/A INTRINSIC
DIL 1687 1792 2.47e-51 SMART
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik C T 3: 145,938,221 P55S probably damaging Het
Adgre4 T C 17: 55,791,497 S136P probably benign Het
Als2cr12 A T 1: 58,659,278 V327D possibly damaging Het
Arap1 C A 7: 101,373,015 A8E probably damaging Het
Arid1a A T 4: 133,753,090 H174Q possibly damaging Het
Btbd2 A G 10: 80,644,705 I358T probably benign Het
Camkk2 G A 5: 122,737,512 R492* probably null Het
Capn3 T C 2: 120,463,940 V23A probably benign Het
Carm1 T G 9: 21,580,310 V225G probably benign Het
Ccdc113 T A 8: 95,540,831 N141K probably benign Het
Ccdc60 C A 5: 116,146,184 M298I probably benign Het
Celsr3 C T 9: 108,845,817 P2801L probably benign Het
Clec4n T A 6: 123,230,546 V23E probably damaging Het
Cmtr2 T G 8: 110,221,750 L231V probably damaging Het
Csrnp3 T G 2: 66,023,019 V585G probably null Het
Ctnnd2 T C 15: 30,647,111 S318P probably damaging Het
Cubn A T 2: 13,340,017 probably null Het
Dgkd C A 1: 87,929,827 P754T possibly damaging Het
Dnah7a A G 1: 53,684,983 S108P probably benign Het
Dnajc24 A G 2: 106,001,923 probably benign Het
Dner A T 1: 84,445,456 S475R probably damaging Het
Doxl2 C T 6: 48,975,753 T204I probably damaging Het
Dtnb T C 12: 3,781,190 L630P probably benign Het
Dysf T C 6: 84,073,903 F411L probably benign Het
Fam208a T C 14: 27,438,664 S128P probably damaging Het
Fam208a C T 14: 27,479,789 H1419Y possibly damaging Het
Fbxo18 G A 2: 11,757,528 A566V probably damaging Het
Fbxw19 G T 9: 109,485,936 T186K probably benign Het
Gm4825 A G 15: 85,511,044 noncoding transcript Het
Grhl2 T A 15: 37,336,314 V54D probably damaging Het
Hmcn1 T C 1: 150,675,991 I2621V probably benign Het
Hmcn1 T A 1: 150,677,376 E2521V possibly damaging Het
Kcng1 A G 2: 168,262,984 V314A probably benign Het
Kif13a G A 13: 46,864,838 probably benign Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kifc1 A G 17: 33,884,587 probably null Het
Klk13 T A 7: 43,721,007 N31K possibly damaging Het
Klri1 T A 6: 129,697,384 H221L probably benign Het
Ltbp4 G A 7: 27,329,018 P273L unknown Het
Med16 T C 10: 79,907,095 H14R possibly damaging Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Mrgpra2a T A 7: 47,427,235 I92F probably benign Het
Muc5b T C 7: 141,862,637 C3107R possibly damaging Het
Ndst4 T A 3: 125,438,682 L300* probably null Het
Nlgn2 G T 11: 69,827,310 D356E probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Oas1f G A 5: 120,856,439 C341Y possibly damaging Het
Olfm5 A T 7: 104,160,412 C111S possibly damaging Het
Olfr1176 T C 2: 88,340,201 L212P probably damaging Het
Olfr523 A T 7: 140,176,683 I188L probably benign Het
Olfr697 T C 7: 106,741,394 E180G probably damaging Het
Olfr821 C T 10: 130,034,318 Q231* probably null Het
Olfr876 A G 9: 37,803,946 I12V probably benign Het
Olfr919 T A 9: 38,698,204 H58L probably benign Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Pde10a T C 17: 8,942,918 I477T possibly damaging Het
Pde4b A G 4: 102,597,460 E108G probably damaging Het
Pdgfrb A T 18: 61,065,783 T338S probably benign Het
Pgghg A G 7: 140,943,347 M180V probably benign Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pot1b A T 17: 55,662,531 Y546N probably damaging Het
Rangap1 T C 15: 81,706,503 T463A probably benign Het
Rap1gds1 T C 3: 139,050,556 I13V probably null Het
Rbak A T 5: 143,174,682 Y205* probably null Het
Reg3b A T 6: 78,371,814 K31M probably damaging Het
Rfpl4 A T 7: 5,115,534 Y12* probably null Het
Rnase6 A G 14: 51,130,432 N94D possibly damaging Het
Rtn4 T C 11: 29,736,464 L273P probably damaging Het
Ryr3 A C 2: 112,794,467 F2203V probably damaging Het
Sae1 A T 7: 16,368,565 D161E possibly damaging Het
Sema5a T C 15: 32,562,731 F296S possibly damaging Het
Sh3rf1 C A 8: 61,384,863 P814Q probably damaging Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc25a25 C T 2: 32,420,651 probably null Het
Slco4c1 T A 1: 96,867,929 M135L probably benign Het
Slfn1 A G 11: 83,121,753 I232V possibly damaging Het
Slitrk1 T A 14: 108,912,190 N363I probably damaging Het
Srr A G 11: 74,908,716 V311A probably damaging Het
Tenm1 T C X: 42,827,201 D402G probably benign Het
Topors T C 4: 40,261,044 R747G unknown Het
Trank1 A T 9: 111,391,628 I2478F probably damaging Het
Trim69 A G 2: 122,167,684 N46D probably benign Het
Trpm1 T A 7: 64,230,230 L661Q probably damaging Het
Ttbk1 A C 17: 46,480,224 F45V probably damaging Het
Ttn T C 2: 76,814,305 K4708R probably damaging Het
Unkl A G 17: 25,209,645 probably benign Het
Uros A T 7: 133,687,006 N257K probably benign Het
Usp25 A G 16: 77,076,371 Y439C probably damaging Het
Vgf A G 5: 137,032,175 probably benign Het
Vmn2r8 A T 5: 108,799,286 D533E probably damaging Het
Vps13a A T 19: 16,725,631 Y653N probably damaging Het
Zfp358 T C 8: 3,495,742 V135A possibly damaging Het
Other mutations in Myo5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Myo5a APN 9 75161497 nonsense probably null
IGL00547:Myo5a APN 9 75141453 missense probably benign 0.00
IGL00788:Myo5a APN 9 75168959 missense probably benign 0.15
IGL01327:Myo5a APN 9 75187538 splice site probably benign
IGL01687:Myo5a APN 9 75156249 missense probably benign 0.12
IGL01886:Myo5a APN 9 75169090 splice site probably benign
IGL01945:Myo5a APN 9 75140671 missense probably damaging 1.00
IGL02127:Myo5a APN 9 75212981 missense probably benign 0.12
IGL02137:Myo5a APN 9 75161535 splice site probably null
IGL02183:Myo5a APN 9 75167236 splice site probably benign
IGL02427:Myo5a APN 9 75176618 splice site probably benign
IGL02490:Myo5a APN 9 75136455 missense probably damaging 1.00
IGL02574:Myo5a APN 9 75211147 missense probably benign 0.00
IGL02886:Myo5a APN 9 75151887 splice site probably benign
IGL02961:Myo5a APN 9 75215120 missense probably benign 0.04
IGL03090:Myo5a APN 9 75120833 missense probably damaging 1.00
IGL03119:Myo5a APN 9 75174015 missense probably benign 0.01
IGL03237:Myo5a APN 9 75129994 missense probably damaging 1.00
IGL03296:Myo5a APN 9 75116202 missense probably damaging 1.00
naoki UTSW 9 75161492 missense probably damaging 1.00
new_gray UTSW 9 missense
nut UTSW 9 splice donor site
silver_decerebrate UTSW 9 75164195 missense probably damaging 1.00
silver_decerebrate_2 UTSW 9 75211127 missense probably damaging 1.00
IGL02988:Myo5a UTSW 9 75130141 splice site probably benign
IGL03050:Myo5a UTSW 9 75146909 unclassified probably null
PIT4403001:Myo5a UTSW 9 75217523 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0091:Myo5a UTSW 9 75161492 missense probably damaging 1.00
R0142:Myo5a UTSW 9 75160574 missense probably benign 0.01
R0243:Myo5a UTSW 9 75186123 critical splice donor site probably null
R0395:Myo5a UTSW 9 75193977 missense probably benign 0.39
R0427:Myo5a UTSW 9 75174196 missense probably benign 0.00
R0545:Myo5a UTSW 9 75167037 missense possibly damaging 0.94
R0565:Myo5a UTSW 9 75180112 missense probably benign 0.00
R0601:Myo5a UTSW 9 75174015 missense probably benign 0.01
R1457:Myo5a UTSW 9 75213065 missense probably damaging 0.99
R1510:Myo5a UTSW 9 75171551 missense probably benign
R1548:Myo5a UTSW 9 75171746 missense probably damaging 1.00
R1759:Myo5a UTSW 9 75181993 missense possibly damaging 0.72
R1924:Myo5a UTSW 9 75116207 missense probably damaging 1.00
R2050:Myo5a UTSW 9 75146874 missense probably benign 0.01
R2070:Myo5a UTSW 9 75181984 missense probably benign 0.03
R2075:Myo5a UTSW 9 75189918 missense probably benign 0.01
R2148:Myo5a UTSW 9 75180147 missense probably damaging 1.00
R2201:Myo5a UTSW 9 75217943 missense possibly damaging 0.51
R2337:Myo5a UTSW 9 75203801 missense probably damaging 1.00
R2357:Myo5a UTSW 9 75201365 missense probably damaging 0.99
R2392:Myo5a UTSW 9 75209239 missense probably benign 0.02
R2432:Myo5a UTSW 9 75212873 missense possibly damaging 0.89
R2568:Myo5a UTSW 9 75123040 missense probably damaging 1.00
R2568:Myo5a UTSW 9 75151897 missense probably damaging 1.00
R2932:Myo5a UTSW 9 75196136 missense possibly damaging 0.85
R2971:Myo5a UTSW 9 75116202 missense probably damaging 1.00
R4231:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R4293:Myo5a UTSW 9 75144171 missense probably benign
R4321:Myo5a UTSW 9 75217530 missense probably damaging 0.99
R4450:Myo5a UTSW 9 75167176 missense probably benign 0.00
R4573:Myo5a UTSW 9 75201297 synonymous probably null
R4577:Myo5a UTSW 9 75217545 missense probably damaging 1.00
R4601:Myo5a UTSW 9 75136388 missense probably damaging 1.00
R4690:Myo5a UTSW 9 75153823 missense probably damaging 0.99
R4691:Myo5a UTSW 9 75180156 missense probably damaging 0.99
R4764:Myo5a UTSW 9 75116336 intron probably benign
R4767:Myo5a UTSW 9 75144076 missense probably damaging 0.99
R4811:Myo5a UTSW 9 75141543 critical splice donor site probably null
R4829:Myo5a UTSW 9 75136407 missense probably damaging 1.00
R4863:Myo5a UTSW 9 75217507 missense probably damaging 1.00
R4902:Myo5a UTSW 9 75174078 missense probably benign
R4947:Myo5a UTSW 9 75123048 missense probably damaging 1.00
R5074:Myo5a UTSW 9 75174156 missense probably benign
R5095:Myo5a UTSW 9 75152020 missense probably damaging 1.00
R5095:Myo5a UTSW 9 75184389 nonsense probably null
R5254:Myo5a UTSW 9 75130120 missense probably damaging 1.00
R5267:Myo5a UTSW 9 75152010 missense probably damaging 1.00
R5419:Myo5a UTSW 9 75147897 missense probably damaging 1.00
R5514:Myo5a UTSW 9 75153766 missense probably damaging 1.00
R5629:Myo5a UTSW 9 75203845 missense possibly damaging 0.89
R5649:Myo5a UTSW 9 75171719 missense possibly damaging 0.92
R5661:Myo5a UTSW 9 75167206 missense probably benign 0.02
R5665:Myo5a UTSW 9 75144181 critical splice donor site probably null
R5719:Myo5a UTSW 9 75151931 missense probably damaging 1.00
R5964:Myo5a UTSW 9 75203833 missense probably benign 0.09
R6014:Myo5a UTSW 9 75167207 nonsense probably null
R6344:Myo5a UTSW 9 75160509 missense probably benign 0.09
R6345:Myo5a UTSW 9 75189913 missense possibly damaging 0.77
R6644:Myo5a UTSW 9 75146967 missense probably damaging 0.98
R6712:Myo5a UTSW 9 75212900 missense probably benign 0.12
R6838:Myo5a UTSW 9 75153883 critical splice donor site probably null
R6866:Myo5a UTSW 9 75140688 missense probably damaging 1.00
R6876:Myo5a UTSW 9 75160490 missense probably benign 0.04
R7108:Myo5a UTSW 9 75129992 missense probably damaging 1.00
R7159:Myo5a UTSW 9 75171563 missense probably benign 0.07
R7164:Myo5a UTSW 9 75180153 missense probably benign 0.00
R7219:Myo5a UTSW 9 75120770 missense probably damaging 1.00
X0010:Myo5a UTSW 9 75185905 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTACTGGATATGAAGGGGC -3'
(R):5'- CAGGAGTTTATTTCAAAGACCAAGC -3'

Sequencing Primer
(F):5'- GGCTATACATCCTTAGGCAGG -3'
(R):5'- CTTACCATGTTGAATTGTTGT -3'
Posted On2015-05-19