Incidental Mutation 'R1960:Trank1'
ID318055
Institutional Source Beutler Lab
Gene Symbol Trank1
Ensembl Gene ENSMUSG00000062296
Gene Nametetratricopeptide repeat and ankyrin repeat containing 1
SynonymsA230061D21Rik, LOC235639, C030048J01Rik, Lba1
MMRRC Submission 039974-MU
Accession Numbers

Genbank: NM_001164659.1; Ensembl: ENSMUST00000078626

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1960 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location111311739-111395775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111391628 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 2478 (I2478F)
Ref Sequence ENSEMBL: ENSMUSP00000077697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078626]
Predicted Effect probably damaging
Transcript: ENSMUST00000078626
AA Change: I2478F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296
AA Change: I2478F

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Blast:TPR 144 177 1e-15 BLAST
Blast:TPR 178 209 8e-13 BLAST
Blast:ANK 332 361 1e-6 BLAST
ANK 369 405 5.29e0 SMART
ANK 538 567 2.11e2 SMART
ANK 572 609 7.29e2 SMART
ANK 621 652 1.21e2 SMART
low complexity region 887 895 N/A INTRINSIC
low complexity region 1152 1172 N/A INTRINSIC
Blast:AAA 1351 1569 1e-6 BLAST
low complexity region 2166 2177 N/A INTRINSIC
low complexity region 2395 2411 N/A INTRINSIC
low complexity region 2636 2649 N/A INTRINSIC
low complexity region 2966 2983 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198890
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (95/95)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik C T 3: 145,938,221 P55S probably damaging Het
Adgre4 T C 17: 55,791,497 S136P probably benign Het
Als2cr12 A T 1: 58,659,278 V327D possibly damaging Het
Arap1 C A 7: 101,373,015 A8E probably damaging Het
Arid1a A T 4: 133,753,090 H174Q possibly damaging Het
Btbd2 A G 10: 80,644,705 I358T probably benign Het
Camkk2 G A 5: 122,737,512 R492* probably null Het
Capn3 T C 2: 120,463,940 V23A probably benign Het
Carm1 T G 9: 21,580,310 V225G probably benign Het
Ccdc113 T A 8: 95,540,831 N141K probably benign Het
Ccdc60 C A 5: 116,146,184 M298I probably benign Het
Celsr3 C T 9: 108,845,817 P2801L probably benign Het
Clec4n T A 6: 123,230,546 V23E probably damaging Het
Cmtr2 T G 8: 110,221,750 L231V probably damaging Het
Csrnp3 T G 2: 66,023,019 V585G probably null Het
Ctnnd2 T C 15: 30,647,111 S318P probably damaging Het
Cubn A T 2: 13,340,017 probably null Het
Dgkd C A 1: 87,929,827 P754T possibly damaging Het
Dnah7a A G 1: 53,684,983 S108P probably benign Het
Dnajc24 A G 2: 106,001,923 probably benign Het
Dner A T 1: 84,445,456 S475R probably damaging Het
Doxl2 C T 6: 48,975,753 T204I probably damaging Het
Dtnb T C 12: 3,781,190 L630P probably benign Het
Dysf T C 6: 84,073,903 F411L probably benign Het
Fam208a T C 14: 27,438,664 S128P probably damaging Het
Fam208a C T 14: 27,479,789 H1419Y possibly damaging Het
Fbxo18 G A 2: 11,757,528 A566V probably damaging Het
Fbxw19 G T 9: 109,485,936 T186K probably benign Het
Gm4825 A G 15: 85,511,044 noncoding transcript Het
Grhl2 T A 15: 37,336,314 V54D probably damaging Het
Hmcn1 T C 1: 150,675,991 I2621V probably benign Het
Hmcn1 T A 1: 150,677,376 E2521V possibly damaging Het
Kcng1 A G 2: 168,262,984 V314A probably benign Het
Kif13a G A 13: 46,864,838 probably benign Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kifc1 A G 17: 33,884,587 probably null Het
Klk13 T A 7: 43,721,007 N31K possibly damaging Het
Klri1 T A 6: 129,697,384 H221L probably benign Het
Ltbp4 G A 7: 27,329,018 P273L unknown Het
Med16 T C 10: 79,907,095 H14R possibly damaging Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Mrgpra2a T A 7: 47,427,235 I92F probably benign Het
Muc5b T C 7: 141,862,637 C3107R possibly damaging Het
Myo5a T A 9: 75,147,857 F441I probably damaging Het
Ndst4 T A 3: 125,438,682 L300* probably null Het
Nlgn2 G T 11: 69,827,310 D356E probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Oas1f G A 5: 120,856,439 C341Y possibly damaging Het
Olfm5 A T 7: 104,160,412 C111S possibly damaging Het
Olfr1176 T C 2: 88,340,201 L212P probably damaging Het
Olfr523 A T 7: 140,176,683 I188L probably benign Het
Olfr697 T C 7: 106,741,394 E180G probably damaging Het
Olfr821 C T 10: 130,034,318 Q231* probably null Het
Olfr876 A G 9: 37,803,946 I12V probably benign Het
Olfr919 T A 9: 38,698,204 H58L probably benign Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Pde10a T C 17: 8,942,918 I477T possibly damaging Het
Pde4b A G 4: 102,597,460 E108G probably damaging Het
Pdgfrb A T 18: 61,065,783 T338S probably benign Het
Pgghg A G 7: 140,943,347 M180V probably benign Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pot1b A T 17: 55,662,531 Y546N probably damaging Het
Rangap1 T C 15: 81,706,503 T463A probably benign Het
Rap1gds1 T C 3: 139,050,556 I13V probably null Het
Rbak A T 5: 143,174,682 Y205* probably null Het
Reg3b A T 6: 78,371,814 K31M probably damaging Het
Rfpl4 A T 7: 5,115,534 Y12* probably null Het
Rnase6 A G 14: 51,130,432 N94D possibly damaging Het
Rtn4 T C 11: 29,736,464 L273P probably damaging Het
Ryr3 A C 2: 112,794,467 F2203V probably damaging Het
Sae1 A T 7: 16,368,565 D161E possibly damaging Het
Sema5a T C 15: 32,562,731 F296S possibly damaging Het
Sh3rf1 C A 8: 61,384,863 P814Q probably damaging Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc25a25 C T 2: 32,420,651 probably null Het
Slco4c1 T A 1: 96,867,929 M135L probably benign Het
Slfn1 A G 11: 83,121,753 I232V possibly damaging Het
Slitrk1 T A 14: 108,912,190 N363I probably damaging Het
Srr A G 11: 74,908,716 V311A probably damaging Het
Tenm1 T C X: 42,827,201 D402G probably benign Het
Topors T C 4: 40,261,044 R747G unknown Het
Trim69 A G 2: 122,167,684 N46D probably benign Het
Trpm1 T A 7: 64,230,230 L661Q probably damaging Het
Ttbk1 A C 17: 46,480,224 F45V probably damaging Het
Ttn T C 2: 76,814,305 K4708R probably damaging Het
Unkl A G 17: 25,209,645 probably benign Het
Uros A T 7: 133,687,006 N257K probably benign Het
Usp25 A G 16: 77,076,371 Y439C probably damaging Het
Vgf A G 5: 137,032,175 probably benign Het
Vmn2r8 A T 5: 108,799,286 D533E probably damaging Het
Vps13a A T 19: 16,725,631 Y653N probably damaging Het
Zfp358 T C 8: 3,495,742 V135A possibly damaging Het
Other mutations in Trank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Trank1 APN 9 111392609 missense probably damaging 1.00
IGL00467:Trank1 APN 9 111364666 splice site probably benign
IGL00569:Trank1 APN 9 111345511 missense possibly damaging 0.69
IGL00585:Trank1 APN 9 111349290 missense possibly damaging 0.82
IGL01070:Trank1 APN 9 111366793 missense probably damaging 1.00
IGL01134:Trank1 APN 9 111391781 missense probably benign
IGL01154:Trank1 APN 9 111386400 missense probably benign 0.00
IGL01355:Trank1 APN 9 111365520 missense possibly damaging 0.94
IGL01407:Trank1 APN 9 111364722 missense probably damaging 0.99
IGL01410:Trank1 APN 9 111365049 missense probably benign 0.00
IGL01410:Trank1 APN 9 111365259 missense probably benign 0.00
IGL01504:Trank1 APN 9 111373544 missense probably damaging 1.00
IGL01744:Trank1 APN 9 111349363 missense probably damaging 1.00
IGL02043:Trank1 APN 9 111363960 missense probably damaging 0.98
IGL02104:Trank1 APN 9 111390712 missense possibly damaging 0.85
IGL02193:Trank1 APN 9 111367276 missense probably benign 0.43
IGL02581:Trank1 APN 9 111383125 missense probably benign 0.00
IGL02630:Trank1 APN 9 111373075 missense possibly damaging 0.70
IGL02839:Trank1 APN 9 111364756 missense probably damaging 1.00
IGL02897:Trank1 APN 9 111367517 missense probably damaging 0.99
IGL03065:Trank1 APN 9 111390293 missense possibly damaging 0.64
IGL03123:Trank1 APN 9 111367407 missense probably damaging 1.00
IGL03143:Trank1 APN 9 111366087 missense probably damaging 1.00
IGL03323:Trank1 APN 9 111352116 missense probably damaging 1.00
1mM(1):Trank1 UTSW 9 111392981 missense probably damaging 1.00
R0035:Trank1 UTSW 9 111366776 missense probably benign 0.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0089:Trank1 UTSW 9 111392910 missense probably benign 0.00
R0207:Trank1 UTSW 9 111366253 missense probably damaging 1.00
R0255:Trank1 UTSW 9 111366024 missense possibly damaging 0.92
R0334:Trank1 UTSW 9 111365353 missense probably benign 0.00
R0334:Trank1 UTSW 9 111392940 missense probably damaging 1.00
R0383:Trank1 UTSW 9 111391477 missense probably benign 0.08
R0421:Trank1 UTSW 9 111391839 missense probably damaging 1.00
R0494:Trank1 UTSW 9 111391293 missense probably benign 0.19
R0518:Trank1 UTSW 9 111333808 missense probably damaging 1.00
R0560:Trank1 UTSW 9 111391086 missense possibly damaging 0.88
R0637:Trank1 UTSW 9 111390441 missense probably damaging 1.00
R0731:Trank1 UTSW 9 111365488 missense probably damaging 1.00
R0761:Trank1 UTSW 9 111366613 missense probably damaging 1.00
R0766:Trank1 UTSW 9 111347469 missense probably benign 0.45
R0827:Trank1 UTSW 9 111349417 unclassified probably benign
R1005:Trank1 UTSW 9 111333721 missense probably benign 0.13
R1108:Trank1 UTSW 9 111365307 missense probably benign 0.00
R1155:Trank1 UTSW 9 111366970 missense possibly damaging 0.95
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1596:Trank1 UTSW 9 111366290 missense possibly damaging 0.93
R1601:Trank1 UTSW 9 111373477 missense probably damaging 1.00
R1751:Trank1 UTSW 9 111391479 missense probably benign
R1754:Trank1 UTSW 9 111392871 missense probably benign 0.00
R1767:Trank1 UTSW 9 111391479 missense probably benign
R1768:Trank1 UTSW 9 111392927 missense probably damaging 0.96
R1809:Trank1 UTSW 9 111392825 missense probably benign 0.34
R1912:Trank1 UTSW 9 111390709 missense probably benign 0.00
R1920:Trank1 UTSW 9 111347928 critical splice donor site probably null
R1993:Trank1 UTSW 9 111378832 missense probably benign 0.20
R2012:Trank1 UTSW 9 111365028 missense probably benign
R2025:Trank1 UTSW 9 111392039 missense probably benign 0.01
R2050:Trank1 UTSW 9 111364788 missense probably damaging 1.00
R2857:Trank1 UTSW 9 111366933 missense probably benign 0.00
R2912:Trank1 UTSW 9 111392483 missense probably damaging 0.98
R2962:Trank1 UTSW 9 111352080 missense probably damaging 1.00
R3030:Trank1 UTSW 9 111391530 missense possibly damaging 0.63
R3821:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3822:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3892:Trank1 UTSW 9 111364759 missense probably benign 0.03
R4105:Trank1 UTSW 9 111352197 missense probably damaging 1.00
R4166:Trank1 UTSW 9 111373524 nonsense probably null
R4237:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4239:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4394:Trank1 UTSW 9 111365197 missense possibly damaging 0.86
R4417:Trank1 UTSW 9 111365968 missense probably benign 0.17
R4611:Trank1 UTSW 9 111362261 missense probably damaging 1.00
R4694:Trank1 UTSW 9 111392061 missense probably benign 0.40
R4731:Trank1 UTSW 9 111390410 missense probably damaging 1.00
R4843:Trank1 UTSW 9 111366078 missense probably benign 0.00
R4852:Trank1 UTSW 9 111391895 missense possibly damaging 0.68
R4859:Trank1 UTSW 9 111365010 missense probably benign 0.17
R4868:Trank1 UTSW 9 111365641 missense probably damaging 1.00
R5080:Trank1 UTSW 9 111389221 missense probably damaging 0.99
R5156:Trank1 UTSW 9 111390694 missense probably damaging 1.00
R5174:Trank1 UTSW 9 111365559 missense probably benign 0.00
R5234:Trank1 UTSW 9 111386467 missense probably damaging 1.00
R5386:Trank1 UTSW 9 111362402 missense probably benign 0.12
R5419:Trank1 UTSW 9 111391301 missense probably damaging 1.00
R5435:Trank1 UTSW 9 111391890 missense probably benign 0.00
R5444:Trank1 UTSW 9 111392958 missense probably benign 0.04
R5543:Trank1 UTSW 9 111366112 missense probably damaging 0.97
R5560:Trank1 UTSW 9 111390567 missense probably damaging 1.00
R5772:Trank1 UTSW 9 111366676 missense possibly damaging 0.86
R5774:Trank1 UTSW 9 111391226 missense probably damaging 1.00
R5843:Trank1 UTSW 9 111365860 missense possibly damaging 0.59
R5858:Trank1 UTSW 9 111392536 missense probably benign
R5878:Trank1 UTSW 9 111366685 missense possibly damaging 0.93
R5900:Trank1 UTSW 9 111391716 missense probably damaging 1.00
R5917:Trank1 UTSW 9 111362417 missense probably benign 0.38
R5954:Trank1 UTSW 9 111365133 missense probably benign 0.13
R6041:Trank1 UTSW 9 111377796 missense possibly damaging 0.94
R6112:Trank1 UTSW 9 111391737 missense probably damaging 1.00
R6165:Trank1 UTSW 9 111391872 missense probably benign 0.00
R6255:Trank1 UTSW 9 111352246 critical splice donor site probably null
R6395:Trank1 UTSW 9 111367200 missense probably damaging 1.00
R6567:Trank1 UTSW 9 111347521 missense probably benign 0.02
R6644:Trank1 UTSW 9 111364834 missense possibly damaging 0.85
R6724:Trank1 UTSW 9 111365916 missense probably damaging 1.00
R6788:Trank1 UTSW 9 111390679 missense probably damaging 1.00
R6831:Trank1 UTSW 9 111377899 missense probably benign 0.00
R6934:Trank1 UTSW 9 111373090 missense probably damaging 0.99
X0064:Trank1 UTSW 9 111343236 missense possibly damaging 0.57
Z1088:Trank1 UTSW 9 111364710 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTCGAGTCTGACAGAGAG -3'
(R):5'- GCTCTGGTCACATCCTTTGG -3'

Sequencing Primer
(F):5'- CATAGAAGGGAAGTTTGGCATGTTG -3'
(R):5'- CTCTTGGATGATGGAGAACACCTC -3'
Posted On2015-05-19