Incidental Mutation 'R2201:Fdxr'
ID318093
Institutional Source Beutler Lab
Gene Symbol Fdxr
Ensembl Gene ENSMUSG00000018861
Gene Nameferredoxin reductase
Synonyms
MMRRC Submission 040203-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R2201 (G1)
Quality Score64
Status Validated
Chromosome11
Chromosomal Location115268024-115277050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 115270382 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 223 (V223L)
Ref Sequence ENSEMBL: ENSMUSP00000021078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003351] [ENSMUST00000021078] [ENSMUST00000106554]
Predicted Effect probably benign
Transcript: ENSMUST00000003351
SMART Domains Protein: ENSMUSP00000003351
Gene: ENSMUSG00000020734

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 99 299 5.1e-12 PFAM
PBPe 440 796 1.11e-79 SMART
Lig_chan-Glu_bd 448 500 2.79e-18 SMART
transmembrane domain 816 835 N/A INTRINSIC
Pfam:NMDAR2_C 837 924 6.8e-15 PFAM
low complexity region 941 975 N/A INTRINSIC
low complexity region 1041 1058 N/A INTRINSIC
low complexity region 1063 1076 N/A INTRINSIC
low complexity region 1173 1182 N/A INTRINSIC
low complexity region 1194 1203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021078
AA Change: V223L

PolyPhen 2 Score 0.414 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021078
Gene: ENSMUSG00000018861
AA Change: V223L

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:Pyr_redox_2 41 246 2.9e-10 PFAM
low complexity region 273 286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106554
SMART Domains Protein: ENSMUSP00000102164
Gene: ENSMUSG00000020734

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 100 306 6.9e-10 PFAM
PBPe 440 796 1.11e-79 SMART
Lig_chan-Glu_bd 448 500 2.79e-18 SMART
transmembrane domain 816 835 N/A INTRINSIC
Pfam:NMDAR2_C 837 926 1.1e-13 PFAM
low complexity region 941 975 N/A INTRINSIC
low complexity region 1041 1058 N/A INTRINSIC
low complexity region 1063 1076 N/A INTRINSIC
low complexity region 1173 1182 N/A INTRINSIC
low complexity region 1194 1203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155130
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial flavoprotein that initiates electron transport for cytochromes P450 receiving electrons from NADPH. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T A 7: 29,536,525 noncoding transcript Het
A2ml1 A T 6: 128,547,305 N1121K probably null Het
Actr10 A G 12: 70,960,021 N351D probably damaging Het
Adcy7 G A 8: 88,317,978 A500T probably damaging Het
Ankrd35 T C 3: 96,679,248 I80T possibly damaging Het
Arap2 G A 5: 62,706,685 T532I probably damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
C77080 A G 4: 129,222,639 V732A probably benign Het
Cc2d2a T C 5: 43,684,033 probably benign Het
Cep85l A T 10: 53,348,731 M254K probably benign Het
Clic4 A G 4: 135,223,539 S114P probably damaging Het
Ctsj T C 13: 61,002,549 Y213C probably damaging Het
Ddx28 A G 8: 106,010,574 V284A probably damaging Het
Dnase2b T A 3: 146,584,688 D176V probably damaging Het
Dsg2 T A 18: 20,596,054 N663K probably damaging Het
Dst T A 1: 34,195,921 S3694T possibly damaging Het
Emilin1 T C 5: 30,915,692 S158P probably benign Het
Eng T C 2: 32,673,740 probably benign Het
Fam160a2 T C 7: 105,388,191 N395S probably damaging Het
Fam189a1 T A 7: 64,759,393 M418L probably benign Het
Frem2 T A 3: 53,516,573 M3148L probably benign Het
Hip1 A T 5: 135,431,730 D114E probably benign Het
Itga9 T C 9: 118,877,115 probably benign Het
Kcnt2 T A 1: 140,509,441 N487K probably damaging Het
Krt6a A G 15: 101,693,171 F172L probably benign Het
Megf8 C T 7: 25,340,745 R1034W probably damaging Het
Muc6 C T 7: 141,649,810 D451N probably damaging Het
Myo5a A G 9: 75,217,943 T1838A possibly damaging Het
N4bp2l2 A T 5: 150,661,608 D302E probably damaging Het
Nbeal2 T A 9: 110,630,250 I1930F probably benign Het
Npas4 A T 19: 4,987,364 Y301N probably benign Het
Nt5m A G 11: 59,875,915 K211E probably benign Het
Pfn4 A G 12: 4,774,382 probably null Het
Pfpl A C 19: 12,430,479 D698A probably benign Het
Pias1 G T 9: 62,951,855 H124N possibly damaging Het
Pja2 A T 17: 64,311,167 probably benign Het
Polr3e T C 7: 120,932,242 Y185H probably benign Het
Pomc T C 12: 3,960,275 L172S probably benign Het
Rapgef4 A G 2: 72,045,189 T129A probably damaging Het
Reep1 T C 6: 71,773,294 S97P probably damaging Het
Rttn T A 18: 89,010,943 I595N possibly damaging Het
Sap30 T C 8: 57,485,472 probably null Het
Slc1a7 T C 4: 107,993,006 Y105H probably damaging Het
Slc5a5 C T 8: 70,892,458 M68I probably damaging Het
Stab2 T A 10: 86,940,639 Y791F probably benign Het
Tdrd1 C A 19: 56,858,661 S911R probably benign Het
Tdrd1 C A 19: 56,858,662 H912N probably benign Het
Tgm7 A T 2: 121,098,581 F278Y probably damaging Het
Tln2 T C 9: 67,375,757 T310A probably damaging Het
Tmem256 T C 11: 69,839,445 I93T probably benign Het
Trpm2 G A 10: 77,920,471 Q1172* probably null Het
Ttll8 A G 15: 88,933,953 V173A possibly damaging Het
Ubr5 T C 15: 38,002,299 S1497G possibly damaging Het
Ubr7 G A 12: 102,761,505 probably null Het
Vmn1r37 T A 6: 66,731,894 M1K probably null Het
Vmn2r14 A G 5: 109,218,832 probably null Het
Vmn2r72 T C 7: 85,738,236 I707V probably benign Het
Vps8 A G 16: 21,576,757 R1266G probably damaging Het
Zfhx4 A G 3: 5,242,289 N192D probably damaging Het
Zfp638 G C 6: 83,929,518 D222H probably damaging Het
Zscan29 A C 2: 121,169,402 V106G probably damaging Het
Other mutations in Fdxr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Fdxr APN 11 115269576 missense probably benign
IGL02524:Fdxr APN 11 115271260 critical splice donor site probably null
IGL03195:Fdxr APN 11 115276092 missense probably benign 0.29
R0371:Fdxr UTSW 11 115276089 missense possibly damaging 0.66
R0749:Fdxr UTSW 11 115276845 missense probably benign
R1165:Fdxr UTSW 11 115271782 unclassified probably benign
R1819:Fdxr UTSW 11 115276104 missense probably damaging 0.96
R2507:Fdxr UTSW 11 115271980 missense probably damaging 0.98
R2508:Fdxr UTSW 11 115271980 missense probably damaging 0.98
R3701:Fdxr UTSW 11 115269701 missense probably damaging 0.99
R5004:Fdxr UTSW 11 115269573 missense probably benign 0.05
R5333:Fdxr UTSW 11 115272258 missense probably benign 0.13
R5944:Fdxr UTSW 11 115269846 missense probably benign
R7124:Fdxr UTSW 11 115269577 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCAACTGAATCATCTCCCG -3'
(R):5'- AGACCGACTAGCCTTGCAAG -3'

Sequencing Primer
(F):5'- GAATCATCTCCCGAAGCTCCTTGAG -3'
(R):5'- CAAGGTCAGATATTTAGCCGTGGC -3'
Posted On2015-05-20