Incidental Mutation 'R4171:Cd200r1'
ID318150
Institutional Source Beutler Lab
Gene Symbol Cd200r1
Ensembl Gene ENSMUSG00000022667
Gene NameCD200 receptor 1
SynonymsMox2r, OX2R, CD200R
MMRRC Submission 041011-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R4171 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location44765736-44794978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44792764 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 244 (I244M)
Ref Sequence ENSEMBL: ENSMUSP00000053822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057488] [ENSMUST00000134625] [ENSMUST00000231633]
PDB Structure
Structure of the extracellular portion of mouse CD200R [X-RAY DIFFRACTION]
Structure of the complex of the extracellular portions of mouse CD200R and mouse CD200 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000057488
AA Change: I244M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053822
Gene: ENSMUSG00000022667
AA Change: I244M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 44 147 2.41e-6 SMART
Blast:IG_like 149 231 8e-47 BLAST
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134625
SMART Domains Protein: ENSMUSP00000138076
Gene: ENSMUSG00000022667

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 44 147 2.41e-6 SMART
Blast:IG_like 149 231 8e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231633
Meta Mutation Damage Score 0.0328 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for the OX-2 membrane glycoprotein. Both the receptor and substrate are cell surface glycoproteins containing two immunoglobulin-like domains. This receptor is restricted to the surfaces of myeloid lineage cells and the receptor-substrate interaction may function as a myeloid downregulatory signal. Mouse studies of a related gene suggest that this interaction may control myeloid function in a tissue-specific manner. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display abnormal sleep patterns including fragmented vigilance states and diminished duration of wakefulness. Mice homozygous for a different knock-out allele exhibit protection from HSV-1 encephalitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
2310022A10Rik A G 7: 27,565,684 N87S probably benign Het
5330417C22Rik G T 3: 108,460,943 Q885K probably benign Het
Apmap A G 2: 150,584,067 V387A probably benign Het
B130024G19Rik C T 7: 70,388,706 noncoding transcript Het
Clic6 T C 16: 92,497,061 probably benign Het
Col11a1 A G 3: 114,208,214 D429G probably damaging Het
Dsg4 T A 18: 20,458,579 Y458* probably null Het
Fbxl13 A G 5: 21,543,788 Y378H probably benign Het
Ifi203 A C 1: 173,933,775 probably benign Het
Ifna6 T C 4: 88,827,801 V129A probably benign Het
Igkv3-4 G A 6: 70,672,340 A108T probably damaging Het
Itga1 G A 13: 115,030,886 Q165* probably null Het
Kdm4c T A 4: 74,280,898 Y108N possibly damaging Het
Lap3 T C 5: 45,509,491 S412P probably benign Het
Lrfn5 G A 12: 61,843,382 V486I probably damaging Het
Mep1b A T 18: 21,095,106 probably null Het
Mettl6 T C 14: 31,493,667 N52S probably damaging Het
Nup54 A G 5: 92,417,484 I458T possibly damaging Het
Olfr1 A C 11: 73,395,539 L161R probably damaging Het
Olfr773 G A 10: 129,186,584 A279V probably benign Het
Pecr A T 1: 72,276,269 N107K probably damaging Het
Pnpla6 A G 8: 3,543,997 Q1307R probably benign Het
Poll T C 19: 45,556,053 K310E probably damaging Het
Rab29 A G 1: 131,867,737 Q29R probably benign Het
Reg2 G A 6: 78,406,591 G99D probably damaging Het
Rftn2 G A 1: 55,214,270 S58L probably damaging Het
Rps6kb1 T C 11: 86,544,579 E43G possibly damaging Het
Sdk2 T C 11: 113,866,989 probably null Het
Slc38a6 T A 12: 73,350,552 Y323N probably benign Het
Sp100 T C 1: 85,706,841 S152P probably benign Het
Tmc5 A G 7: 118,649,587 Y605C probably damaging Het
Txndc17 T C 11: 72,207,711 Y30H probably damaging Het
Vmn1r44 T A 6: 89,894,014 F247L probably damaging Het
Zbtb39 C T 10: 127,742,367 T270I possibly damaging Het
Zfp512b G A 2: 181,590,598 probably null Het
Zwilch T A 9: 64,158,715 R255* probably null Het
Other mutations in Cd200r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Cd200r1 APN 16 44794309 missense possibly damaging 0.88
IGL02111:Cd200r1 APN 16 44788781 missense probably damaging 0.99
IGL02549:Cd200r1 APN 16 44789978 missense probably damaging 1.00
IGL03065:Cd200r1 APN 16 44794282 missense probably benign 0.00
R0218:Cd200r1 UTSW 16 44788743 splice site probably benign
R1512:Cd200r1 UTSW 16 44766027 missense probably benign 0.21
R3605:Cd200r1 UTSW 16 44789576 missense possibly damaging 0.90
R3877:Cd200r1 UTSW 16 44790011 missense probably damaging 0.97
R3963:Cd200r1 UTSW 16 44792795 missense probably benign 0.03
R4109:Cd200r1 UTSW 16 44790084 missense possibly damaging 0.95
R4296:Cd200r1 UTSW 16 44789670 missense probably damaging 0.98
R4396:Cd200r1 UTSW 16 44766054 missense probably benign 0.01
R4922:Cd200r1 UTSW 16 44789676 missense probably damaging 1.00
R5090:Cd200r1 UTSW 16 44789561 missense possibly damaging 0.79
R5302:Cd200r1 UTSW 16 44792809 missense possibly damaging 0.86
R5686:Cd200r1 UTSW 16 44790164 missense probably damaging 1.00
R5838:Cd200r1 UTSW 16 44766034 missense possibly damaging 0.75
R5886:Cd200r1 UTSW 16 44790203 missense possibly damaging 0.75
R5913:Cd200r1 UTSW 16 44789671 missense possibly damaging 0.50
R6529:Cd200r1 UTSW 16 44789702 missense possibly damaging 0.81
R6959:Cd200r1 UTSW 16 44790176 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGGAATTATGTAATTGATCAAGGAC -3'
(R):5'- GTCCCTTTTGCTTACAAGAACATTG -3'

Sequencing Primer
(F):5'- CTGGAGGATAGGGTTTTACAACACTC -3'
(R):5'- GTTGTTCCTGCCTAATGTAACAG -3'
Posted On2015-06-10