Incidental Mutation 'R4173:Timd2'
ID318214
Institutional Source Beutler Lab
Gene Symbol Timd2
Ensembl Gene ENSMUSG00000040413
Gene NameT cell immunoglobulin and mucin domain containing 2
SynonymsTIM-2, Tim2
MMRRC Submission 041012-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R4173 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location46668960-46707061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46670960 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 286 (T286A)
Ref Sequence ENSEMBL: ENSMUSP00000131540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055102] [ENSMUST00000109225] [ENSMUST00000169584]
Predicted Effect probably benign
Transcript: ENSMUST00000055102
AA Change: T286A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000060891
Gene: ENSMUSG00000040413
AA Change: T286A

DomainStartEndE-ValueType
IG 22 127 7.08e-4 SMART
low complexity region 131 146 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109225
AA Change: T286A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000104848
Gene: ENSMUSG00000040413
AA Change: T286A

DomainStartEndE-ValueType
IG 22 127 7.08e-4 SMART
low complexity region 131 146 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169584
AA Change: T286A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000131540
Gene: ENSMUSG00000040413
AA Change: T286A

DomainStartEndE-ValueType
IG 22 127 7.08e-4 SMART
low complexity region 131 146 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an exacerbated inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cdk1 T C 10: 69,345,161 D73G probably benign Het
Cspg4 A G 9: 56,887,930 E983G probably damaging Het
Gnmt A G 17: 46,726,121 V217A probably damaging Het
Myo5c A G 9: 75,246,258 E142G probably damaging Het
Nr1h5 C T 3: 102,952,230 R171H probably damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Opcml C T 9: 28,903,358 T302I probably benign Het
Pcdha11 T C 18: 37,012,623 V589A probably damaging Het
Pigl T A 11: 62,458,511 F18I probably benign Het
Pip4k2b T C 11: 97,722,375 K265R probably benign Het
Rora C A 9: 68,653,910 T35K probably benign Het
Serpinb9e A G 13: 33,255,158 N189S probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc25a45 C A 19: 5,880,583 Y99* probably null Het
Smgc T C 15: 91,860,561 S655P possibly damaging Het
Thbs2 A C 17: 14,681,631 probably null Het
Trav6d-3 A G 14: 52,725,349 I14M probably benign Het
Trim28 A G 7: 13,029,878 D622G probably benign Het
Txnl4b G A 8: 109,569,074 V37I probably benign Het
Ubr1 C T 2: 120,946,622 probably null Het
Vps13c A G 9: 67,936,313 N1959D probably benign Het
Xkr4 A G 1: 3,216,488 F493S probably damaging Het
Xrn2 T C 2: 147,047,692 V665A probably damaging Het
Other mutations in Timd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Timd2 APN 11 46676343 missense probably benign 0.15
IGL01289:Timd2 APN 11 46679672 missense probably benign 0.00
IGL02066:Timd2 APN 11 46678223 missense probably damaging 0.98
IGL02439:Timd2 APN 11 46678236 splice site probably benign
R2217:Timd2 UTSW 11 46687017 missense probably damaging 1.00
R2218:Timd2 UTSW 11 46687017 missense probably damaging 1.00
R2240:Timd2 UTSW 11 46678216 missense probably benign 0.01
R3621:Timd2 UTSW 11 46678213 missense probably benign 0.00
R3876:Timd2 UTSW 11 46671020 critical splice acceptor site probably null
R4793:Timd2 UTSW 11 46687181 missense probably damaging 1.00
R4799:Timd2 UTSW 11 46677267 nonsense probably null
R4963:Timd2 UTSW 11 46682790 missense possibly damaging 0.66
R5314:Timd2 UTSW 11 46677260 missense probably benign 0.09
R5798:Timd2 UTSW 11 46677237 missense probably benign 0.06
R6074:Timd2 UTSW 11 46687172 missense possibly damaging 0.88
R6090:Timd2 UTSW 11 46687236 missense probably benign 0.11
R6694:Timd2 UTSW 11 46670952 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGTGTACACAGTAGAGGGTTACC -3'
(R):5'- AATACTGAGGGCCTGTGTGG -3'

Sequencing Primer
(F):5'- CCTCTCCACTACAGCTGGAAG -3'
(R):5'- AGGGCCTGTGTGGAACTATTCAC -3'
Posted On2015-06-10