Incidental Mutation 'R4174:Gpsm2'
ID318231
Institutional Source Beutler Lab
Gene Symbol Gpsm2
Ensembl Gene ENSMUSG00000027883
Gene NameG-protein signalling modulator 2 (AGS3-like, C. elegans)
SynonymsLGN, 6230410J09Rik, Pins
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.724) question?
Stock #R4174 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location108678638-108722309 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108702509 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 102 (A102T)
Ref Sequence ENSEMBL: ENSMUSP00000029482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029482] [ENSMUST00000145558]
PDB Structure
Structures of the LGN/NuMA complex [X-RAY DIFFRACTION]
crystal structure of LGN/mInscuteable complex [X-RAY DIFFRACTION]
Structure complex of LGN binding with FRMPD1 [X-RAY DIFFRACTION]
Structure of LGN GL4/Galphai3(Q147L) complex [X-RAY DIFFRACTION]
Structure of LGN GL4/Galphai1 complex [X-RAY DIFFRACTION]
Structure of LGN GL4/Galphai3 complex [X-RAY DIFFRACTION]
Structure of LGN GL3/Galphai3 complex [X-RAY DIFFRACTION]
An auto-inhibited conformation of LGN reveals a distinct interaction mode between GoLoco motifs and TPR motifs [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000029482
AA Change: A102T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029482
Gene: ENSMUSG00000027883
AA Change: A102T

DomainStartEndE-ValueType
TPR 62 95 7.86e-3 SMART
TPR 102 135 4.34e-5 SMART
Blast:TPR 142 188 9e-22 BLAST
TPR 202 235 1.69e-2 SMART
TPR 242 275 3.99e-4 SMART
TPR 282 315 1.51e-4 SMART
TPR 322 355 1.04e-2 SMART
GoLoco 490 512 3.69e-9 SMART
low complexity region 518 527 N/A INTRINSIC
GoLoco 543 565 7.27e-8 SMART
GoLoco 594 616 2.31e-10 SMART
GoLoco 628 650 2.75e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124043
Predicted Effect probably damaging
Transcript: ENSMUST00000145558
AA Change: A102T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115759
Gene: ENSMUSG00000027883
AA Change: A102T

DomainStartEndE-ValueType
Blast:TPR 24 57 1e-10 BLAST
Pfam:TPR_8 61 84 1.5e-2 PFAM
Pfam:TPR_10 61 101 3.6e-5 PFAM
Pfam:TPR_1 62 86 7.6e-6 PFAM
Pfam:TPR_2 62 94 2e-5 PFAM
Pfam:TPR_7 64 99 1e-4 PFAM
Pfam:TPR_12 101 154 4.6e-10 PFAM
Pfam:TPR_2 102 134 7e-4 PFAM
Pfam:TPR_1 102 135 2.2e-8 PFAM
Pfam:TPR_8 102 136 5.8e-3 PFAM
Pfam:TPR_7 104 139 4.3e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154263
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of proteins that modulate activation of G proteins, which transduce extracellular signals received by cell surface receptors into integrated cellular responses. The N-terminal half of this protein contains 10 copies of leu-gly-asn (LGN) repeat, and the C-terminal half contains 4 GoLoco motifs, which are involved in guanine nucleotide exchange. This protein may play a role in neuroblast division and in the development of normal hearing. Mutations in this gene are associated with autosomal recessive nonsyndromic deafness (DFNB82). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Targeted disruption of this gene randomizes the spindle orientation of normally planar neuroepithelial divisions. The ensuing loss of the apical membrane from daughter cells frequently converts them into abnormally localized progenitors with no apparent effect on neuronal production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T C 1: 38,207,927 H859R probably damaging Het
Agap2 T C 10: 127,090,514 V876A probably damaging Het
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cep70 T C 9: 99,246,313 probably benign Het
Ddx23 G A 15: 98,658,251 S62F unknown Het
Gabrp A G 11: 33,568,092 I72T probably damaging Het
Metap2 A G 10: 93,879,565 C112R possibly damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Olfr901 T A 9: 38,431,020 I246K probably damaging Het
Pde12 A T 14: 26,668,989 D188E probably benign Het
Pirb A T 7: 3,716,032 probably null Het
Rreb1 T A 13: 37,930,150 L495Q possibly damaging Het
Slc12a5 T C 2: 164,979,490 I275T probably damaging Het
Tas2r122 A G 6: 132,711,876 I18T probably damaging Het
Tdrkh A G 3: 94,428,233 T378A possibly damaging Het
Ubr1 C T 2: 120,946,622 probably null Het
Zglp1 A G 9: 21,066,070 F150L possibly damaging Het
Other mutations in Gpsm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01597:Gpsm2 APN 3 108696987 missense probably benign 0.00
IGL01754:Gpsm2 APN 3 108703045 missense probably damaging 1.00
IGL02624:Gpsm2 APN 3 108682033 missense probably benign 0.01
IGL03005:Gpsm2 APN 3 108687006 splice site probably benign
R0482:Gpsm2 UTSW 3 108702394 splice site probably benign
R1793:Gpsm2 UTSW 3 108700909 missense probably benign 0.14
R1796:Gpsm2 UTSW 3 108701850 missense probably damaging 0.99
R7048:Gpsm2 UTSW 3 108703045 missense probably damaging 1.00
Z1088:Gpsm2 UTSW 3 108700760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATGGAAGTAGTGCTAGAACAC -3'
(R):5'- CTAGTAATGGAGCAACCCTAGAG -3'

Sequencing Primer
(F):5'- GTAGTGCTAGAACACAAAACTACTTC -3'
(R):5'- AACTAGGGAAGGCTGTTTCAATTTG -3'
Posted On2015-06-10