Incidental Mutation 'R4175:Olfr994'
ID318250
Institutional Source Beutler Lab
Gene Symbol Olfr994
Ensembl Gene ENSMUSG00000075219
Gene Nameolfactory receptor 994
SynonymsMOR203-4, GA_x6K02T2Q125-46907515-46906571
MMRRC Submission 041013-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R4175 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85429380-85436451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85430618 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 70 (D70E)
Ref Sequence ENSEMBL: ENSMUSP00000149417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099925] [ENSMUST00000214679] [ENSMUST00000217218]
Predicted Effect probably damaging
Transcript: ENSMUST00000099925
AA Change: D70E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097509
Gene: ENSMUSG00000075219
AA Change: D70E

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 5.1e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 302 3.5e-5 PFAM
Pfam:7tm_1 41 289 8.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214679
AA Change: D70E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215758
Predicted Effect probably damaging
Transcript: ENSMUST00000217218
AA Change: D70E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd63 T C 2: 118,702,619 M274V probably benign Het
Ano6 A T 15: 95,962,169 D724V probably damaging Het
Apobec3 A G 15: 79,895,452 N43S probably damaging Het
Arfgef1 T C 1: 10,159,636 H1280R probably damaging Het
Cbfa2t3 C T 8: 122,643,318 V139M probably damaging Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Clmp A T 9: 40,771,136 N72I probably benign Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
Creb3l1 A G 2: 91,983,175 F506L probably benign Het
Ctbp1 A G 5: 33,266,906 S47P probably damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dus1l G A 11: 120,795,680 R12C possibly damaging Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Epb41l4b A G 4: 57,076,556 V326A probably damaging Het
Fhdc1 T C 3: 84,456,987 probably benign Het
Gm27013 T A 6: 130,677,147 T451S probably benign Het
Ifi208 A T 1: 173,682,701 M141L probably benign Het
Inpp5e A G 2: 26,400,925 S377P probably damaging Het
Kat2a A G 11: 100,705,266 L822P probably damaging Het
Kcnip2 G C 19: 45,812,215 T24S probably benign Het
Med17 A G 9: 15,267,469 Y469H possibly damaging Het
Mindy3 C T 2: 12,405,865 C77Y probably damaging Het
Mmp1a A G 9: 7,467,235 T271A probably benign Het
Ncor2 A T 5: 125,050,956 S118T probably damaging Het
Osmr A T 15: 6,852,546 V39D probably damaging Het
Pcdh15 G A 10: 74,631,997 probably benign Het
Pclo A G 5: 14,713,875 K836E probably damaging Het
Pik3r1 A T 13: 101,701,732 L272H probably damaging Het
Pik3r1 G A 13: 101,701,733 L272F probably benign Het
Prrc2b G GCT 2: 32,218,808 probably benign Het
Ptprq T G 10: 107,711,917 I207L probably benign Het
Rasa2 G T 9: 96,560,777 T531K probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a6 G A 9: 108,854,217 probably benign Het
Slc7a13 G A 4: 19,819,492 G231R probably null Het
Slco3a1 T A 7: 74,318,554 N473Y probably damaging Het
Tapt1 G A 5: 44,177,105 L515F probably benign Het
Tmem145 T C 7: 25,308,793 I253T probably benign Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Unc13a A G 8: 71,667,724 probably benign Het
Usp24 T C 4: 106,316,773 V101A probably benign Het
Zfp36l3 T C X: 53,775,873 T125A possibly damaging Het
Other mutations in Olfr994
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Olfr994 APN 2 85430140 missense probably benign 0.00
IGL01325:Olfr994 APN 2 85430295 missense possibly damaging 0.60
IGL01634:Olfr994 APN 2 85430439 missense probably damaging 1.00
IGL01809:Olfr994 APN 2 85430154 missense probably damaging 1.00
IGL02586:Olfr994 APN 2 85430466 missense possibly damaging 0.80
IGL02711:Olfr994 APN 2 85430739 missense probably damaging 0.97
R0010:Olfr994 UTSW 2 85429895 missense probably benign
R0578:Olfr994 UTSW 2 85430673 missense probably benign 0.03
R0848:Olfr994 UTSW 2 85430021 missense probably benign 0.03
R1844:Olfr994 UTSW 2 85429921 missense probably benign 0.03
R1912:Olfr994 UTSW 2 85430260 missense probably damaging 0.97
R1959:Olfr994 UTSW 2 85430619 missense probably damaging 1.00
R2014:Olfr994 UTSW 2 85430352 missense possibly damaging 0.89
R2113:Olfr994 UTSW 2 85430086 missense probably damaging 1.00
R2290:Olfr994 UTSW 2 85430200 missense possibly damaging 0.64
R3622:Olfr994 UTSW 2 85430493 missense probably benign 0.12
R3918:Olfr994 UTSW 2 85430730 missense possibly damaging 0.64
R4945:Olfr994 UTSW 2 85430551 missense probably benign 0.03
R6132:Olfr994 UTSW 2 85430146 missense probably benign 0.06
R6439:Olfr994 UTSW 2 85430724 missense probably damaging 1.00
R6713:Olfr994 UTSW 2 85430539 missense probably damaging 1.00
R7065:Olfr994 UTSW 2 85430179 missense probably damaging 1.00
R7089:Olfr994 UTSW 2 85430558 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGGGCTTACAGATTGCCAC -3'
(R):5'- CTTGGTAGCTATGACACAAGGC -3'

Sequencing Primer
(F):5'- TTACAGATTGCCACATACCGGTC -3'
(R):5'- TGGCACTGAAGTCACTGAC -3'
Posted On2015-06-10