Incidental Mutation 'R4191:Adgrl1'
List |< first << previous [record 72 of 1871] next >> last >|
ID318312
Institutional Source Beutler Lab
Gene Symbol Adgrl1
Ensembl Gene ENSMUSG00000013033
Gene Nameadhesion G protein-coupled receptor L1
Synonymslectomedin-2, Lec2, Lphn1, 2900070I05Rik
MMRRC Submission 041022-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4191 (G1)
Quality Score180
Status Validated
Chromosome8
Chromosomal Location83900105-83941954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 83938940 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 1464 (R1464G)
Ref Sequence ENSEMBL: ENSMUSP00000119100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045393] [ENSMUST00000098595] [ENSMUST00000124355] [ENSMUST00000131717] [ENSMUST00000132500] [ENSMUST00000141158] [ENSMUST00000152978]
Predicted Effect probably benign
Transcript: ENSMUST00000045393
AA Change: R1424G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048422
Gene: ENSMUSG00000013033
AA Change: R1424G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 6.6e-23 PFAM
OLF 142 398 8.5e-138 SMART
low complexity region 405 441 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
HormR 476 541 1.4e-23 SMART
low complexity region 579 591 N/A INTRINSIC
low complexity region 747 758 N/A INTRINSIC
GPS 797 849 3.5e-27 SMART
Pfam:7tm_2 856 1092 5.3e-66 PFAM
Pfam:Latrophilin 1112 1470 1.7e-177 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098595
SMART Domains Protein: ENSMUSP00000096195
Gene: ENSMUSG00000074219

DomainStartEndE-ValueType
low complexity region 60 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124355
SMART Domains Protein: ENSMUSP00000116064
Gene: ENSMUSG00000013033

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131018
SMART Domains Protein: ENSMUSP00000117720
Gene: ENSMUSG00000013033

DomainStartEndE-ValueType
Pfam:Latrophilin 1 213 9.2e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131717
AA Change: R1248G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118579
Gene: ENSMUSG00000013033
AA Change: R1248G

DomainStartEndE-ValueType
OLF 1 222 4.51e-103 SMART
low complexity region 229 265 N/A INTRINSIC
low complexity region 279 294 N/A INTRINSIC
HormR 300 365 2.26e-21 SMART
low complexity region 403 415 N/A INTRINSIC
low complexity region 571 582 N/A INTRINSIC
GPS 621 673 5.64e-25 SMART
Pfam:7tm_2 680 916 7.9e-68 PFAM
Pfam:Latrophilin 936 1295 2.7e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132500
AA Change: R1464G

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119100
Gene: ENSMUSG00000013033
AA Change: R1464G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 1.6e-25 PFAM
OLF 137 393 1.39e-135 SMART
low complexity region 400 436 N/A INTRINSIC
low complexity region 450 465 N/A INTRINSIC
HormR 471 536 2.26e-21 SMART
low complexity region 574 586 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
GPS 792 844 5.64e-25 SMART
Pfam:7tm_2 851 1087 3.4e-68 PFAM
Pfam:Latrophilin 1146 1511 6.4e-193 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141158
AA Change: R1419G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118452
Gene: ENSMUSG00000013033
AA Change: R1419G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 3.4e-25 PFAM
OLF 137 393 1.39e-135 SMART
low complexity region 400 436 N/A INTRINSIC
low complexity region 450 465 N/A INTRINSIC
HormR 471 536 2.26e-21 SMART
low complexity region 574 586 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
GPS 792 844 5.64e-25 SMART
Pfam:7tm_2 851 1087 4.5e-68 PFAM
Pfam:Latrophilin 1107 1466 1.1e-180 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150674
Predicted Effect probably benign
Transcript: ENSMUST00000152978
AA Change: R1469G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115295
Gene: ENSMUSG00000013033
AA Change: R1469G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 2.1e-25 PFAM
OLF 142 398 1.39e-135 SMART
low complexity region 405 441 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
HormR 476 541 2.26e-21 SMART
Pfam:GAIN 544 773 4.1e-59 PFAM
GPS 797 849 5.64e-25 SMART
Pfam:7tm_2 856 1092 2.3e-69 PFAM
Pfam:Latrophilin 1112 1516 7.3e-136 PFAM
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors (GPCR). Latrophilins may function in both cell adhesion and signal transduction. In experiments with non-human species, endogenous proteolytic cleavage within a cysteine-rich GPS (G-protein-coupled-receptor proteolysis site) domain resulted in two subunits (a large extracellular N-terminal cell adhesion subunit and a subunit with substantial similarity to the secretin/calcitonin family of GPCRs) being non-covalently bound at the cell membrane. Latrophilin-1 has been shown to recruit the neurotoxin from black widow spider venom, alpha-latrotoxin, to the synapse plasma membrane. Alternative splicing results in multiple variants encoding distinct isoforms.[provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a targeted null allele at this locus are viable and fertile. Female homozygotes fail adequately to care for their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C T 17: 47,436,637 R61H probably damaging Het
Abcc1 A G 16: 14,389,864 T22A probably damaging Het
Ache A T 5: 137,291,072 I347F probably damaging Het
Cdh11 T C 8: 102,650,748 D422G probably damaging Het
Cdx1 C T 18: 61,020,438 S176N possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Cyct G T 2: 76,354,191 P72Q probably damaging Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Disp1 G T 1: 183,089,173 A561E probably damaging Het
Donson C A 16: 91,688,592 A41S possibly damaging Het
Gldc T C 19: 30,145,658 E279G probably damaging Het
Gpr160 A T 3: 30,896,714 I312F possibly damaging Het
H2-Eb2 G A 17: 34,344,555 probably benign Het
Igdcc4 A G 9: 65,124,151 Q457R probably benign Het
Irf2bp2 T C 8: 126,593,345 D31G probably damaging Het
Klrb1 T A 6: 128,713,634 K42* probably null Het
Lrrfip1 A T 1: 91,110,399 E446D probably benign Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Maml3 A G 3: 51,689,969 V1098A probably benign Het
Mrgpra4 T C 7: 47,981,119 S245G probably benign Het
Mybbp1a A G 11: 72,451,287 E1283G probably damaging Het
Myh2 A G 11: 67,177,400 S285G possibly damaging Het
Myh7b A G 2: 155,633,399 D1876G probably benign Het
Nr4a2 T C 2: 57,112,379 S21G probably damaging Het
Olfr1049 C A 2: 86,255,322 V124L probably benign Het
Olfr1384 T A 11: 49,513,812 M58K probably damaging Het
Olfr251 T A 9: 38,378,352 M157K probably damaging Het
Olfr843 A G 9: 19,249,087 V104A probably benign Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Pex10 T C 4: 155,067,905 probably null Het
Pgf T C 12: 85,171,787 D63G probably benign Het
Piwil4 A G 9: 14,715,000 S465P probably damaging Het
Plcb1 A C 2: 135,345,090 H759P probably damaging Het
Pmfbp1 A T 8: 109,527,628 M432L probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Rmnd1 A T 10: 4,410,809 probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Svep1 C T 4: 58,046,601 C3510Y possibly damaging Het
Tanc1 A G 2: 59,839,013 I1274V probably damaging Het
Tep1 T C 14: 50,836,806 E1874G probably damaging Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tlk1 G A 2: 70,725,547 R423C probably damaging Het
Trove2 T C 1: 143,770,786 I74V probably benign Het
Trp53rkb T C 2: 166,795,475 I117T probably damaging Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vit A G 17: 78,586,826 H219R probably benign Het
Zfp112 A G 7: 24,126,143 D512G probably benign Het
Zfyve19 A G 2: 119,210,831 K76R possibly damaging Het
Other mutations in Adgrl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Adgrl1 APN 8 83937703 missense probably damaging 0.98
IGL01413:Adgrl1 APN 8 83929857 missense probably damaging 1.00
IGL02020:Adgrl1 APN 8 83932948 missense probably benign 0.09
IGL02422:Adgrl1 APN 8 83937486 missense probably damaging 1.00
IGL03065:Adgrl1 APN 8 83938514 missense possibly damaging 0.95
IGL03169:Adgrl1 APN 8 83931995 missense probably damaging 0.97
IGL03237:Adgrl1 APN 8 83929683 unclassified probably null
Swiss_rolls UTSW 8 83918922 missense
R0375:Adgrl1 UTSW 8 83934901 missense probably damaging 0.99
R0505:Adgrl1 UTSW 8 83934650 splice site probably benign
R0681:Adgrl1 UTSW 8 83934650 splice site probably benign
R0964:Adgrl1 UTSW 8 83934412 splice site probably benign
R1182:Adgrl1 UTSW 8 83929822 missense probably damaging 1.00
R1373:Adgrl1 UTSW 8 83937763 missense probably benign 0.23
R1475:Adgrl1 UTSW 8 83938350 missense possibly damaging 0.60
R1610:Adgrl1 UTSW 8 83932373 missense probably benign 0.16
R1778:Adgrl1 UTSW 8 83930037 missense probably damaging 1.00
R2089:Adgrl1 UTSW 8 83934464 missense probably damaging 1.00
R2091:Adgrl1 UTSW 8 83934464 missense probably damaging 1.00
R2091:Adgrl1 UTSW 8 83934464 missense probably damaging 1.00
R2300:Adgrl1 UTSW 8 83930117 nonsense probably null
R2403:Adgrl1 UTSW 8 83931241 missense probably benign 0.01
R2935:Adgrl1 UTSW 8 83934560 missense probably damaging 1.00
R3772:Adgrl1 UTSW 8 83923004 missense possibly damaging 0.59
R4393:Adgrl1 UTSW 8 83938593 missense probably benign 0.01
R4406:Adgrl1 UTSW 8 83930042 missense probably damaging 1.00
R4445:Adgrl1 UTSW 8 83934860 missense probably damaging 1.00
R4782:Adgrl1 UTSW 8 83935573 missense probably benign 0.08
R4799:Adgrl1 UTSW 8 83935573 missense probably benign 0.08
R5214:Adgrl1 UTSW 8 83915573 splice site probably null
R5242:Adgrl1 UTSW 8 83931082 missense possibly damaging 0.47
R5409:Adgrl1 UTSW 8 83929742 missense probably damaging 1.00
R5522:Adgrl1 UTSW 8 83923075 missense possibly damaging 0.93
R5607:Adgrl1 UTSW 8 83937257 missense probably damaging 1.00
R5608:Adgrl1 UTSW 8 83937257 missense probably damaging 1.00
R5652:Adgrl1 UTSW 8 83929815 missense probably damaging 1.00
R5655:Adgrl1 UTSW 8 83938601 missense possibly damaging 0.89
R5919:Adgrl1 UTSW 8 83932610 missense probably damaging 1.00
R6033:Adgrl1 UTSW 8 83918922 missense probably damaging 0.99
R6033:Adgrl1 UTSW 8 83918922 missense probably damaging 0.99
R6129:Adgrl1 UTSW 8 83918987 missense probably damaging 1.00
R6221:Adgrl1 UTSW 8 83937687 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATGAGTCGGAGAGCTGTAC -3'
(R):5'- TGTCTACTAACCCTGGCACCTG -3'

Sequencing Primer
(F):5'- GCAGAGGATGGGGCCAC -3'
(R):5'- AGGTCATAGTCCCCAAGGG -3'
Posted On2015-06-10