Incidental Mutation 'R4192:Nkain3'
ID318345
Institutional Source Beutler Lab
Gene Symbol Nkain3
Ensembl Gene ENSMUSG00000055761
Gene NameNa+/K+ transporting ATPase interacting 3
Synonyms
MMRRC Submission 041023-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4192 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location20118874-20778866 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 20485003 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 25 (Q25*)
Ref Sequence ENSEMBL: ENSMUSP00000113113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102998] [ENSMUST00000119374]
Predicted Effect probably null
Transcript: ENSMUST00000102998
AA Change: Q25*
SMART Domains Protein: ENSMUSP00000100063
Gene: ENSMUSG00000055761
AA Change: Q25*

DomainStartEndE-ValueType
Pfam:NKAIN 1 162 1e-85 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119374
AA Change: Q25*
SMART Domains Protein: ENSMUSP00000113113
Gene: ENSMUSG00000055761
AA Change: Q25*

DomainStartEndE-ValueType
Pfam:NKAIN 1 180 7e-83 PFAM
Meta Mutation Damage Score 0.57 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NKAIN3 is a member of a family of mammalian proteins (see NKAIN1; MIM 612871) with similarity to Drosophila Nkain (Gorokhova et al., 2007 [PubMed 17606467]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Acot4 T C 12: 84,043,174 probably benign Het
Add3 C A 19: 53,242,524 D543E probably benign Het
Angpt4 A C 2: 151,943,318 D418A probably benign Het
Ano8 A T 8: 71,483,292 V260D probably damaging Het
Cfh C T 1: 140,102,716 R860H possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Dnajb9 A T 12: 44,207,077 D182E probably benign Het
E330021D16Rik T C 6: 136,401,437 T132A probably benign Het
Epb42 G T 2: 121,030,089 probably null Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam205c A T 4: 42,874,185 probably benign Het
Fer1l6 A G 15: 58,647,149 D1710G probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gm8369 C T 19: 11,502,232 P9S probably damaging Het
Il17ra A G 6: 120,481,511 D541G probably damaging Het
Ints4 T G 7: 97,507,733 H337Q probably damaging Het
Itgam A G 7: 128,064,732 T44A probably benign Het
Lyst C A 13: 13,740,513 T3264N probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Myo3a T A 2: 22,407,377 F728I probably damaging Het
Nacad T C 11: 6,605,534 E72G probably benign Het
Oca2 T C 7: 56,297,249 F342S probably damaging Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Osbpl6 T A 2: 76,585,229 L499Q probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Peak1 A T 9: 56,258,741 N634K probably damaging Het
Pitpnm3 T C 11: 72,051,959 K818R possibly damaging Het
Rab3gap1 T A 1: 127,925,470 probably benign Het
Rcc1l T C 5: 134,155,809 T385A probably benign Het
Rrm2 T C 12: 24,708,378 I11T probably benign Het
Scnn1b A G 7: 121,902,739 T207A possibly damaging Het
Syt12 T A 19: 4,447,681 probably benign Het
Tmprss6 A T 15: 78,446,657 probably null Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r27 A C 6: 58,215,827 I14R probably damaging Het
Other mutations in Nkain3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02610:Nkain3 APN 4 20469459 missense probably damaging 1.00
I1329:Nkain3 UTSW 4 20158329 splice site probably benign
IGL03055:Nkain3 UTSW 4 20778308 missense probably benign 0.01
R0726:Nkain3 UTSW 4 20158388 missense possibly damaging 0.67
R1485:Nkain3 UTSW 4 20484932 missense probably damaging 1.00
R1600:Nkain3 UTSW 4 20469528 splice site probably benign
R1702:Nkain3 UTSW 4 20158339 critical splice donor site probably null
R3707:Nkain3 UTSW 4 20484920 missense possibly damaging 0.65
R4392:Nkain3 UTSW 4 20282985 missense possibly damaging 0.89
R4410:Nkain3 UTSW 4 20778284 missense probably benign 0.20
R4721:Nkain3 UTSW 4 20485015 missense probably damaging 0.98
R5333:Nkain3 UTSW 4 20484889 missense probably benign 0.04
R5978:Nkain3 UTSW 4 20485026 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGGGTGAGTAGCAGAGCATC -3'
(R):5'- AGCTTGATCATCAGCACCAC -3'

Sequencing Primer
(F):5'- GTAGCAGAGCATCCTCTTATAGGC -3'
(R):5'- TTGATCATCAGCACCACAGGAAAAAG -3'
Posted On2015-06-10