Incidental Mutation 'R0394:Clstn1'
ID31845
Institutional Source Beutler Lab
Gene Symbol Clstn1
Ensembl Gene ENSMUSG00000039953
Gene Namecalsyntenin 1
SynonymsCst-1, calsyntenin-1, 1810034E21Rik, alcadein alpha
MMRRC Submission 038600-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0394 (G1)
Quality Score161
Status Validated
Chromosome4
Chromosomal Location149586468-149648899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 149644178 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 687 (D687G)
Ref Sequence ENSEMBL: ENSMUSP00000101316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038859] [ENSMUST00000039144] [ENSMUST00000105690] [ENSMUST00000105691] [ENSMUST00000118704] [ENSMUST00000122059] [ENSMUST00000177654]
Predicted Effect probably benign
Transcript: ENSMUST00000038859
SMART Domains Protein: ENSMUSP00000036434
Gene: ENSMUSG00000039936

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 685 8.56e-87 SMART
PI3Kc 776 1042 5.65e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039144
AA Change: D697G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036962
Gene: ENSMUSG00000039953
AA Change: D697G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 59 162 1.25e-11 SMART
CA 185 263 1.03e-3 SMART
Pfam:Laminin_G_3 365 510 3.3e-9 PFAM
low complexity region 663 674 N/A INTRINSIC
transmembrane domain 860 882 N/A INTRINSIC
coiled coil region 915 949 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105690
SMART Domains Protein: ENSMUSP00000101315
Gene: ENSMUSG00000039936

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 688 1.22e-82 SMART
PI3Kc 778 1044 5.65e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105691
AA Change: D687G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101316
Gene: ENSMUSG00000039953
AA Change: D687G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 59 152 2.91e-12 SMART
CA 175 253 1.03e-3 SMART
Pfam:Laminin_G_3 350 544 1.1e-12 PFAM
low complexity region 653 664 N/A INTRINSIC
transmembrane domain 850 872 N/A INTRINSIC
coiled coil region 905 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118704
SMART Domains Protein: ENSMUSP00000112863
Gene: ENSMUSG00000039936

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 687 1.8e-80 SMART
PI3Kc 777 1043 5.65e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122059
SMART Domains Protein: ENSMUSP00000113844
Gene: ENSMUSG00000039936

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 408 6.47e-23 SMART
PI3Ka 492 681 8.56e-87 SMART
PI3Kc 771 1037 5.65e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177654
SMART Domains Protein: ENSMUSP00000136045
Gene: ENSMUSG00000039936

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 688 1.22e-82 SMART
PI3Kc 778 1044 5.65e-128 SMART
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the calsyntenin family, a subset of the cadherin superfamily. The encoded transmembrane protein, also known as alcadein-alpha, is thought to bind to kinesin-1 motors to mediate the axonal anterograde transport of certain types of vesicle. Amyloid precursor protein (APP) is trafficked via these vesicles and so this protein is being investigated to see how it might contribute to the mechanisms underlying Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Juvenile mice homozygous for a null allele show reduced basal excitatory synaptic transmission, abnormal excitatory postsynaptic currents, enhanced NMDA receptor-dependent long term potentiation, and delayed dendritic spine maturation in CA1 hippocampal pyramidal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,067,304 S751R probably damaging Het
4933417A18Rik T C 13: 34,932,653 probably benign Het
Abca8a A G 11: 110,026,343 V1610A probably damaging Het
Actl10 A T 2: 154,553,037 H202L probably benign Het
Alox12 A T 11: 70,245,935 V489E probably damaging Het
Ap4m1 T A 5: 138,172,203 F5I probably benign Het
Atn1 T C 6: 124,749,733 probably benign Het
Atrnl1 T A 19: 57,673,176 N529K probably benign Het
B3gntl1 C T 11: 121,619,715 G336D probably damaging Het
Bmp1 G A 14: 70,490,034 A703V probably damaging Het
Brat1 T G 5: 140,718,386 L798R probably damaging Het
Cacna1c C T 6: 118,625,497 G1302R probably damaging Het
Cdr2 A T 7: 120,958,731 D190E probably benign Het
Cenpe T C 3: 135,216,425 probably benign Het
Coro1a A G 7: 126,700,640 F337L probably benign Het
Ddx49 T A 8: 70,296,925 I252F probably damaging Het
Dennd2a T A 6: 39,522,812 D273V possibly damaging Het
Derl2 A T 11: 71,014,561 F32I probably benign Het
Dmrta1 A G 4: 89,692,039 Y412C probably damaging Het
Dsg1a A G 18: 20,333,750 N559S probably damaging Het
Dusp26 G T 8: 31,091,959 R27L probably benign Het
Eif2ak3 T C 6: 70,885,218 I492T probably benign Het
Exoc7 G T 11: 116,300,398 Q219K probably damaging Het
F2r T C 13: 95,604,476 T184A probably damaging Het
Fbf1 G A 11: 116,152,462 probably benign Het
Fbxo28 A G 1: 182,317,015 M328T probably benign Het
Fsip2 T A 2: 82,991,075 D5717E possibly damaging Het
Gnpat C A 8: 124,880,225 S373R possibly damaging Het
Golgb1 G T 16: 36,875,579 probably benign Het
Greb1l T C 18: 10,523,374 V844A probably damaging Het
Hps1 G T 19: 42,770,899 probably null Het
Inppl1 G T 7: 101,828,195 probably benign Het
Isca1 C T 13: 59,758,885 probably null Het
Itgb2 T A 10: 77,542,475 C46S probably damaging Het
Kifc5b C T 17: 26,923,082 T178M probably benign Het
Krt80 T C 15: 101,352,299 T22A probably damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Ltbp2 C T 12: 84,806,424 probably benign Het
Mettl18 A G 1: 163,996,341 D77G probably benign Het
Mfsd2a A G 4: 122,950,168 L336P probably benign Het
Mgat4b A G 11: 50,230,919 probably null Het
Mtmr14 C T 6: 113,280,688 R233* probably null Het
Nbea T C 3: 56,029,907 Y761C probably damaging Het
Neb A T 2: 52,177,559 probably null Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Olfr814 T A 10: 129,873,942 I272L probably benign Het
Oxr1 T A 15: 41,817,197 M177K probably damaging Het
Pgm2l1 A G 7: 100,252,198 Y98C probably damaging Het
Pi4kb G T 3: 94,996,804 probably benign Het
Pi4kb G A 3: 94,996,805 probably benign Het
Pirb T A 7: 3,719,248 S199C probably benign Het
Prss23 A C 7: 89,509,847 I338S probably damaging Het
Rapgef3 A T 15: 97,757,819 probably benign Het
Rdh7 T A 10: 127,884,670 T278S probably benign Het
Rnf219 T C 14: 104,478,853 R695G possibly damaging Het
Rrp1b A G 17: 32,058,564 D606G probably benign Het
Rxfp1 T A 3: 79,652,377 Y379F possibly damaging Het
Rxfp2 T C 5: 150,067,388 V514A probably benign Het
Scel A T 14: 103,562,518 E202V probably benign Het
Slc25a36 G A 9: 97,080,204 A244V probably benign Het
Slc2a13 T G 15: 91,516,392 Q209P probably damaging Het
Slc38a6 A G 12: 73,352,530 N456S probably benign Het
Slc6a12 G T 6: 121,346,998 probably null Het
Spag6l T C 16: 16,780,629 I333V probably benign Het
Spen G A 4: 141,474,203 A2371V probably benign Het
St6galnac1 T C 11: 116,766,640 D366G probably damaging Het
Stk33 T C 7: 109,341,489 S5G probably benign Het
Tle2 T C 10: 81,577,648 L84P probably damaging Het
Tmem14a T C 1: 21,226,652 M78T probably damaging Het
Top2b T A 14: 16,413,556 probably null Het
Trmt13 A G 3: 116,582,650 F364S probably damaging Het
Unkl T A 17: 25,230,777 probably null Het
Uvrag A G 7: 99,004,719 probably benign Het
Vmn2r8 T A 5: 108,802,072 N303I probably benign Het
Vsig10l A G 7: 43,465,455 N360S probably damaging Het
Zdhhc25 T C 15: 88,600,920 Y153H probably damaging Het
Zfp646 T C 7: 127,883,262 V1537A possibly damaging Het
Zfp664 T A 5: 124,886,065 Y174* probably null Het
Other mutations in Clstn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Clstn1 APN 4 149635243 missense probably damaging 0.99
IGL00585:Clstn1 APN 4 149638312 missense probably benign 0.05
IGL00911:Clstn1 APN 4 149643191 splice site probably benign
IGL01394:Clstn1 APN 4 149634782 missense possibly damaging 0.87
IGL02193:Clstn1 APN 4 149645352 missense probably benign 0.03
IGL02406:Clstn1 APN 4 149627359 missense probably damaging 1.00
IGL02501:Clstn1 APN 4 149631842 missense probably damaging 1.00
IGL02641:Clstn1 APN 4 149629511 missense probably null 1.00
R0012:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0020:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0021:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0026:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0031:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0038:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0062:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0064:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0193:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0279:Clstn1 UTSW 4 149643674 missense probably damaging 1.00
R0609:Clstn1 UTSW 4 149629300 splice site probably null
R0685:Clstn1 UTSW 4 149646855 missense probably benign 0.24
R0724:Clstn1 UTSW 4 149643624 missense possibly damaging 0.84
R1016:Clstn1 UTSW 4 149646829 missense probably benign 0.21
R1470:Clstn1 UTSW 4 149634722 missense possibly damaging 0.94
R1470:Clstn1 UTSW 4 149634722 missense possibly damaging 0.94
R1622:Clstn1 UTSW 4 149629407 missense probably damaging 0.97
R1680:Clstn1 UTSW 4 149643726 missense probably benign 0.02
R3803:Clstn1 UTSW 4 149635339 missense probably damaging 0.99
R3836:Clstn1 UTSW 4 149638333 missense probably damaging 1.00
R3838:Clstn1 UTSW 4 149638333 missense probably damaging 1.00
R4923:Clstn1 UTSW 4 149645029 missense probably benign 0.07
R5024:Clstn1 UTSW 4 149635294 missense possibly damaging 0.91
R5919:Clstn1 UTSW 4 149635246 missense probably damaging 1.00
R6269:Clstn1 UTSW 4 149644067 missense probably benign 0.00
R6354:Clstn1 UTSW 4 149643216 missense probably benign 0.05
R6382:Clstn1 UTSW 4 149626120 unclassified probably null
R6573:Clstn1 UTSW 4 149643689 missense probably damaging 1.00
X0020:Clstn1 UTSW 4 149635251 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCAACGAGGCGGCTTGCATC -3'
(R):5'- TTGAGCTGGCCCTCAAGCTAAATC -3'

Sequencing Primer
(F):5'- CTTGCATCGAGGTGCCC -3'
(R):5'- tgggaggcagaggcagg -3'
Posted On2013-04-24