Incidental Mutation 'R4194:Ugt1a7c'
ID318463
Institutional Source Beutler Lab
Gene Symbol Ugt1a7c
Ensembl Gene ENSMUSG00000090124
Gene NameUDP glucuronosyltransferase 1 family, polypeptide A7C
SynonymsA10'
MMRRC Submission 041025-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R4194 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location88095062-88220002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88095727 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 203 (T203A)
Ref Sequence ENSEMBL: ENSMUSP00000058683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058237] [ENSMUST00000073772] [ENSMUST00000113139] [ENSMUST00000113142] [ENSMUST00000126203] [ENSMUST00000138182] [ENSMUST00000150634] [ENSMUST00000173325]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058237
AA Change: T203A

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000058683
Gene: ENSMUSG00000090124
AA Change: T203A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 522 1.5e-234 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073772
SMART Domains Protein: ENSMUSP00000073444
Gene: ENSMUSG00000090175

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 519 2.3e-232 PFAM
Pfam:Glyco_tran_28_C 358 447 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113139
SMART Domains Protein: ENSMUSP00000108764
Gene: ENSMUSG00000089675

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 3.6e-237 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113142
SMART Domains Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 7.3e-231 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121495
Predicted Effect probably benign
Transcript: ENSMUST00000126203
SMART Domains Protein: ENSMUSP00000116653
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 4.6e-11 PFAM
Pfam:UDPGT 59 127 8.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138182
SMART Domains Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 7e-11 PFAM
Pfam:UDPGT 58 207 1.9e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150634
SMART Domains Protein: ENSMUSP00000123452
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 9.5e-11 PFAM
Pfam:UDPGT 58 207 2e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173165
Predicted Effect probably benign
Transcript: ENSMUST00000173325
SMART Domains Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 61 3.4e-10 PFAM
Pfam:UDPGT 59 210 8.9e-92 PFAM
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,071 V226E probably damaging Het
Adamtsl1 A T 4: 86,054,008 probably benign Het
Adgrv1 C A 13: 81,498,996 V3142F probably damaging Het
Alms1 C T 6: 85,677,990 Q3173* probably null Het
Ankrd26 A G 6: 118,523,678 F944S probably benign Het
Arhgap11a G T 2: 113,841,994 H210N probably benign Het
Brca1 T C 11: 101,525,287 N674D probably benign Het
Bud13 T A 9: 46,298,495 V634E probably damaging Het
Capn13 C T 17: 73,339,484 M311I possibly damaging Het
Cdyl2 T C 8: 116,579,164 probably null Het
Celsr3 T C 9: 108,843,302 probably null Het
Col6a5 C G 9: 105,945,914 E81D unknown Het
Ctbs C A 3: 146,450,613 H38N probably benign Het
Ctnnd1 T C 2: 84,603,701 D897G possibly damaging Het
Cyp2d41-ps T C 15: 82,781,953 noncoding transcript Het
Dnttip2 G A 3: 122,280,761 E616K probably damaging Het
Epb41l5 A T 1: 119,608,093 S348R probably damaging Het
Fam185a A G 5: 21,425,454 H96R probably benign Het
Fbxo11 T C 17: 88,009,108 D279G possibly damaging Het
Gm3952 C A 8: 128,759,865 G1578V probably damaging Het
Grb7 T A 11: 98,455,055 probably benign Het
Grik1 A G 16: 87,946,728 V537A probably benign Het
H2-Eb2 T A 17: 34,333,326 N48K probably benign Het
Kank3 A G 17: 33,822,263 probably benign Het
Kifap3 T C 1: 163,915,825 S792P probably benign Het
Klhl35 A T 7: 99,473,851 probably null Het
Lpxn T C 19: 12,833,235 F348L probably damaging Het
Mef2d A G 3: 88,158,303 Y114C possibly damaging Het
Mfap3 T A 11: 57,529,703 L170H probably damaging Het
Mical1 C G 10: 41,481,628 F410L possibly damaging Het
Mppe1 G A 18: 67,228,068 S206F probably benign Het
Myo9b C T 8: 71,359,624 A2013V possibly damaging Het
Phactr3 T C 2: 178,283,109 V243A possibly damaging Het
Ppp4r4 T C 12: 103,558,445 L92P probably damaging Het
Rap1gds1 C T 3: 138,959,090 D236N probably damaging Het
Rnf8 T C 17: 29,631,668 probably benign Het
Rpl31-ps17 C T 12: 54,701,649 noncoding transcript Het
Sfta2 T C 17: 35,628,165 probably null Het
Sipa1l2 T A 8: 125,491,672 T309S probably benign Het
Sos1 T C 17: 80,398,584 D1186G probably benign Het
Sptb C A 12: 76,613,010 V1039F probably benign Het
Sycp3 T C 10: 88,463,375 V68A probably benign Het
Tas1r3 T C 4: 155,862,985 E81G probably damaging Het
Ttc3 G A 16: 94,422,277 R253H probably damaging Het
Vtcn1 A T 3: 100,888,209 E164V probably damaging Het
Zan T C 5: 137,463,555 T1121A unknown Het
Zfp473 T C 7: 44,732,252 I885V probably benign Het
Zfp990 A T 4: 145,536,977 probably null Het
Other mutations in Ugt1a7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Ugt1a7c APN 1 88095245 missense probably damaging 0.97
IGL01973:Ugt1a7c APN 1 88095134 missense probably benign 0.00
IGL01990:Ugt1a7c APN 1 88095602 missense probably damaging 1.00
IGL02589:Ugt1a7c APN 1 88095638 missense probably benign 0.00
IGL02625:Ugt1a7c APN 1 88095517 missense possibly damaging 0.94
IGL03381:Ugt1a7c APN 1 88095790 missense probably benign 0.00
R1205:Ugt1a7c UTSW 1 88095956 missense probably benign 0.00
R1667:Ugt1a7c UTSW 1 88095935 missense probably damaging 0.97
R1706:Ugt1a7c UTSW 1 88095725 missense probably damaging 0.99
R1928:Ugt1a7c UTSW 1 88095929 missense probably benign 0.35
R3809:Ugt1a7c UTSW 1 88095382 missense possibly damaging 0.95
R4787:Ugt1a7c UTSW 1 88095670 missense probably damaging 0.99
R5291:Ugt1a7c UTSW 1 88095509 missense possibly damaging 0.48
R5473:Ugt1a7c UTSW 1 88095437 missense probably benign 0.21
R5871:Ugt1a7c UTSW 1 88095659 missense possibly damaging 0.50
R5934:Ugt1a7c UTSW 1 88095879 missense probably damaging 0.99
R6590:Ugt1a7c UTSW 1 88095656 missense possibly damaging 0.85
R6691:Ugt1a7c UTSW 1 88095656 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AAGCAGACTTCTTTTGATGCTGTG -3'
(R):5'- AGATCACATTGGGCATCACAG -3'

Sequencing Primer
(F):5'- ATGCTGTGTTTCTGGATCCTTTC -3'
(R):5'- ACATTGGGCATCACAGGTCTG -3'
Posted On2015-06-10