Incidental Mutation 'R0394:Rxfp2'
ID31850
Institutional Source Beutler Lab
Gene Symbol Rxfp2
Ensembl Gene ENSMUSG00000053368
Gene Namerelaxin/insulin-like family peptide receptor 2
SynonymsGpr106, Great, LGR8
MMRRC Submission 038600-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0394 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location150018675-150082184 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150067388 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 514 (V514A)
Ref Sequence ENSEMBL: ENSMUSP00000106122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065745] [ENSMUST00000110496] [ENSMUST00000201612]
Predicted Effect probably benign
Transcript: ENSMUST00000065745
AA Change: V538A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000067897
Gene: ENSMUSG00000053368
AA Change: V538A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LDLa 27 65 2.55e-11 SMART
LRRNT 93 124 3.83e0 SMART
LRR 120 142 1.71e2 SMART
LRR 143 166 6.77e0 SMART
LRR_TYP 167 190 2.84e-5 SMART
LRR 191 214 7.36e0 SMART
LRR 215 238 1.26e1 SMART
LRR 239 262 2.61e1 SMART
LRR 263 286 8.98e1 SMART
LRR_TYP 287 310 2.24e-3 SMART
LRR 311 334 1.15e1 SMART
LRR 335 358 2.14e1 SMART
Pfam:7tm_1 415 674 1.4e-26 PFAM
low complexity region 682 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110496
AA Change: V514A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106122
Gene: ENSMUSG00000053368
AA Change: V514A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LDLa 27 65 2.55e-11 SMART
LRRNT 93 124 3.83e0 SMART
LRR 120 142 1.71e2 SMART
LRR 143 166 6.77e0 SMART
LRR_TYP 167 190 2.84e-5 SMART
LRR 191 214 7.36e0 SMART
LRR 215 238 1.26e1 SMART
LRR 239 262 2.61e1 SMART
LRR 263 286 2.82e0 SMART
LRR 287 310 1.15e1 SMART
LRR 311 334 2.14e1 SMART
Pfam:7tm_1 391 650 1.5e-27 PFAM
low complexity region 658 671 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143989
Predicted Effect probably benign
Transcript: ENSMUST00000201612
AA Change: V528A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144536
Gene: ENSMUSG00000053368
AA Change: V528A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LDLa 27 65 1.3e-13 SMART
LRRNT 93 124 1.9e-2 SMART
LRR 120 142 7.4e-1 SMART
LRR 143 166 2.9e-2 SMART
LRR_TYP 167 190 1.2e-7 SMART
LRR 229 252 5.4e-2 SMART
LRR 253 276 1.1e-1 SMART
LRR 277 300 1.2e-2 SMART
LRR 301 324 5e-2 SMART
LRR 325 348 9.3e-2 SMART
Pfam:7tm_1 405 664 1.5e-24 PFAM
low complexity region 672 685 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202037
Meta Mutation Damage Score 0.0512 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GPCR (G protein-coupled, 7-transmembrane receptor) family. Mutations in this gene are associated with cryptorchidism. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Male homozygotes for a targeted null mutation exhibit bilateral intraabdominal cryptorchidism and sterility associated with a failure in the differentiation of the gubernaculae, ligaments that control testicular movement during development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,067,304 S751R probably damaging Het
4933417A18Rik T C 13: 34,932,653 probably benign Het
Abca8a A G 11: 110,026,343 V1610A probably damaging Het
Actl10 A T 2: 154,553,037 H202L probably benign Het
Alox12 A T 11: 70,245,935 V489E probably damaging Het
Ap4m1 T A 5: 138,172,203 F5I probably benign Het
Atn1 T C 6: 124,749,733 probably benign Het
Atrnl1 T A 19: 57,673,176 N529K probably benign Het
B3gntl1 C T 11: 121,619,715 G336D probably damaging Het
Bmp1 G A 14: 70,490,034 A703V probably damaging Het
Brat1 T G 5: 140,718,386 L798R probably damaging Het
Cacna1c C T 6: 118,625,497 G1302R probably damaging Het
Cdr2 A T 7: 120,958,731 D190E probably benign Het
Cenpe T C 3: 135,216,425 probably benign Het
Clstn1 A G 4: 149,644,178 D687G probably benign Het
Coro1a A G 7: 126,700,640 F337L probably benign Het
Ddx49 T A 8: 70,296,925 I252F probably damaging Het
Dennd2a T A 6: 39,522,812 D273V possibly damaging Het
Derl2 A T 11: 71,014,561 F32I probably benign Het
Dmrta1 A G 4: 89,692,039 Y412C probably damaging Het
Dsg1a A G 18: 20,333,750 N559S probably damaging Het
Dusp26 G T 8: 31,091,959 R27L probably benign Het
Eif2ak3 T C 6: 70,885,218 I492T probably benign Het
Exoc7 G T 11: 116,300,398 Q219K probably damaging Het
F2r T C 13: 95,604,476 T184A probably damaging Het
Fbf1 G A 11: 116,152,462 probably benign Het
Fbxo28 A G 1: 182,317,015 M328T probably benign Het
Fsip2 T A 2: 82,991,075 D5717E possibly damaging Het
Gnpat C A 8: 124,880,225 S373R possibly damaging Het
Golgb1 G T 16: 36,875,579 probably benign Het
Greb1l T C 18: 10,523,374 V844A probably damaging Het
Hps1 G T 19: 42,770,899 probably null Het
Inppl1 G T 7: 101,828,195 probably benign Het
Isca1 C T 13: 59,758,885 probably null Het
Itgb2 T A 10: 77,542,475 C46S probably damaging Het
Kifc5b C T 17: 26,923,082 T178M probably benign Het
Krt80 T C 15: 101,352,299 T22A probably damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Ltbp2 C T 12: 84,806,424 probably benign Het
Mettl18 A G 1: 163,996,341 D77G probably benign Het
Mfsd2a A G 4: 122,950,168 L336P probably benign Het
Mgat4b A G 11: 50,230,919 probably null Het
Mtmr14 C T 6: 113,280,688 R233* probably null Het
Nbea T C 3: 56,029,907 Y761C probably damaging Het
Neb A T 2: 52,177,559 probably null Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Olfr814 T A 10: 129,873,942 I272L probably benign Het
Oxr1 T A 15: 41,817,197 M177K probably damaging Het
Pgm2l1 A G 7: 100,252,198 Y98C probably damaging Het
Pi4kb G T 3: 94,996,804 probably benign Het
Pi4kb G A 3: 94,996,805 probably benign Het
Pirb T A 7: 3,719,248 S199C probably benign Het
Prss23 A C 7: 89,509,847 I338S probably damaging Het
Rapgef3 A T 15: 97,757,819 probably benign Het
Rdh7 T A 10: 127,884,670 T278S probably benign Het
Rnf219 T C 14: 104,478,853 R695G possibly damaging Het
Rrp1b A G 17: 32,058,564 D606G probably benign Het
Rxfp1 T A 3: 79,652,377 Y379F possibly damaging Het
Scel A T 14: 103,562,518 E202V probably benign Het
Slc25a36 G A 9: 97,080,204 A244V probably benign Het
Slc2a13 T G 15: 91,516,392 Q209P probably damaging Het
Slc38a6 A G 12: 73,352,530 N456S probably benign Het
Slc6a12 G T 6: 121,346,998 probably null Het
Spag6l T C 16: 16,780,629 I333V probably benign Het
Spen G A 4: 141,474,203 A2371V probably benign Het
St6galnac1 T C 11: 116,766,640 D366G probably damaging Het
Stk33 T C 7: 109,341,489 S5G probably benign Het
Tle2 T C 10: 81,577,648 L84P probably damaging Het
Tmem14a T C 1: 21,226,652 M78T probably damaging Het
Top2b T A 14: 16,413,556 probably null Het
Trmt13 A G 3: 116,582,650 F364S probably damaging Het
Unkl T A 17: 25,230,777 probably null Het
Uvrag A G 7: 99,004,719 probably benign Het
Vmn2r8 T A 5: 108,802,072 N303I probably benign Het
Vsig10l A G 7: 43,465,455 N360S probably damaging Het
Zdhhc25 T C 15: 88,600,920 Y153H probably damaging Het
Zfp646 T C 7: 127,883,262 V1537A possibly damaging Het
Zfp664 T A 5: 124,886,065 Y174* probably null Het
Other mutations in Rxfp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Rxfp2 APN 5 150066428 missense probably benign
IGL00984:Rxfp2 APN 5 150067132 missense probably benign 0.24
IGL02475:Rxfp2 APN 5 150063686 missense probably benign 0.07
IGL02637:Rxfp2 APN 5 150055913 missense probably damaging 0.99
IGL02992:Rxfp2 APN 5 150051556 missense probably benign 0.01
IGL03052:Rxfp2 APN 5 150043180
IGL03203:Rxfp2 APN 5 150063680 missense probably benign 0.08
R0158:Rxfp2 UTSW 5 150051628 missense probably benign 0.14
R0499:Rxfp2 UTSW 5 150066415 missense probably damaging 1.00
R0576:Rxfp2 UTSW 5 150038247 missense probably benign 0.01
R0720:Rxfp2 UTSW 5 150044119 missense probably benign 0.04
R1172:Rxfp2 UTSW 5 150051556 missense probably benign 0.01
R1173:Rxfp2 UTSW 5 150051556 missense probably benign 0.01
R1174:Rxfp2 UTSW 5 150051556 missense probably benign 0.01
R1175:Rxfp2 UTSW 5 150051556 missense probably benign 0.01
R1606:Rxfp2 UTSW 5 150059897 missense probably benign
R1720:Rxfp2 UTSW 5 150043099 nonsense probably null
R2040:Rxfp2 UTSW 5 150070212 missense probably benign
R3029:Rxfp2 UTSW 5 150043130 missense probably benign 0.05
R3905:Rxfp2 UTSW 5 150055985 splice site probably null
R4056:Rxfp2 UTSW 5 150051633 critical splice donor site probably null
R4156:Rxfp2 UTSW 5 150051555 missense probably benign 0.01
R4282:Rxfp2 UTSW 5 150070270 missense possibly damaging 0.94
R4418:Rxfp2 UTSW 5 150048800 missense probably benign
R4935:Rxfp2 UTSW 5 150051632 critical splice donor site probably null
R5010:Rxfp2 UTSW 5 150067360 missense probably damaging 1.00
R5286:Rxfp2 UTSW 5 150035444 missense probably damaging 1.00
R5373:Rxfp2 UTSW 5 150070260 missense probably benign 0.21
R5374:Rxfp2 UTSW 5 150070260 missense probably benign 0.21
R5530:Rxfp2 UTSW 5 150056810 missense probably damaging 1.00
R5844:Rxfp2 UTSW 5 150043124 missense probably benign 0.00
R6021:Rxfp2 UTSW 5 150063737 missense possibly damaging 0.46
R6211:Rxfp2 UTSW 5 150044126 splice site probably null
R6401:Rxfp2 UTSW 5 150043130 missense probably benign
R6841:Rxfp2 UTSW 5 150018745 start gained probably benign
X0067:Rxfp2 UTSW 5 150051618 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTATCAGAAGTATGCGCTGCTGTG -3'
(R):5'- AGGGTTTCAGGACTGGGCACTAAC -3'

Sequencing Primer
(F):5'- ATGGAGAGTGTGCCCTGC -3'
(R):5'- CCACACTAAATCTCAGCaataaaaag -3'
Posted On2013-04-24