Incidental Mutation 'R4196:Wnk4'
ID318572
Institutional Source Beutler Lab
Gene Symbol Wnk4
Ensembl Gene ENSMUSG00000035112
Gene NameWNK lysine deficient protein kinase 4
Synonyms2010002J11Rik, Prkwnk4
MMRRC Submission 041027-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.679) question?
Stock #R4196 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101260567-101277409 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101269631 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 697 (V697E)
Ref Sequence ENSEMBL: ENSMUSP00000099397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103108] [ENSMUST00000139487] [ENSMUST00000147741] [ENSMUST00000170056]
Predicted Effect probably damaging
Transcript: ENSMUST00000103108
AA Change: V697E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099397
Gene: ENSMUSG00000035112
AA Change: V697E

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 126 155 N/A INTRINSIC
Pfam:Pkinase_Tyr 171 427 4.7e-42 PFAM
Pfam:Pkinase 171 429 9e-55 PFAM
Pfam:OSR1_C 450 486 3e-18 PFAM
low complexity region 503 513 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 544 560 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 660 678 N/A INTRINSIC
low complexity region 757 778 N/A INTRINSIC
low complexity region 793 808 N/A INTRINSIC
low complexity region 841 877 N/A INTRINSIC
low complexity region 882 915 N/A INTRINSIC
low complexity region 921 951 N/A INTRINSIC
low complexity region 1014 1033 N/A INTRINSIC
low complexity region 1093 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139487
SMART Domains Protein: ENSMUSP00000129666
Gene: ENSMUSG00000035112

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 126 155 N/A INTRINSIC
Pfam:Pkinase_Tyr 171 242 4e-8 PFAM
Pfam:Pkinase 171 252 1.9e-10 PFAM
low complexity region 269 283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147741
SMART Domains Protein: ENSMUSP00000131298
Gene: ENSMUSG00000035112

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 126 155 N/A INTRINSIC
Pfam:Pkinase 171 394 9.3e-50 PFAM
Pfam:Pkinase_Tyr 171 399 3.7e-38 PFAM
low complexity region 401 413 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156205
Predicted Effect probably benign
Transcript: ENSMUST00000170056
SMART Domains Protein: ENSMUSP00000132123
Gene: ENSMUSG00000035112

DomainStartEndE-ValueType
Pfam:OSR1_C 13 49 8.6e-20 PFAM
low complexity region 66 76 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNK family of serine-threonine protein kinases. The kinase is part of the tight junction complex in kidney cells, and regulates the balance between NaCl reabsorption and K(+) secretion. The kinase regulates the activities of several types of ion channels, cotransporters, and exchangers involved in electrolyte flux in epithelial cells. Mutations in this gene result in pseudohypoaldosteronism type IIB.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele display increased Na+, K+ and Cl- urinary excretion, alkalosis and decreased plasma Cl-, K+, Mg2+ and renin levels. Mice homozygous for a point mutation exhibit acidosis, hypertension, increased circulating potassium levels and decreased potassium excretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,263,556 probably benign Het
Acmsd T G 1: 127,749,194 L152R probably damaging Het
Ankle2 A G 5: 110,244,543 K472E possibly damaging Het
Aup1 T C 6: 83,055,230 V126A probably damaging Het
Baz1a T C 12: 54,911,415 Y1014C probably damaging Het
Bcl9 A T 3: 97,216,368 probably benign Het
Cnot2 A T 10: 116,501,304 N221K possibly damaging Het
Col19a1 G A 1: 24,534,052 S213L unknown Het
Eif4enif1 T C 11: 3,243,186 V675A possibly damaging Het
Elp3 A G 14: 65,548,002 L450P probably damaging Het
Erbb4 C T 1: 68,343,855 D328N possibly damaging Het
Fbll1 T A 11: 35,797,872 H188L possibly damaging Het
Frem2 A G 3: 53,539,268 F2360L possibly damaging Het
Gm2396 A G 9: 88,917,662 noncoding transcript Het
Gulo G T 14: 65,988,253 P375T possibly damaging Het
Hspd1 T C 1: 55,086,909 M11V probably benign Het
Ikbkap A T 4: 56,755,353 N1295K probably damaging Het
Itgav A G 2: 83,768,327 T243A probably benign Het
Lipg C T 18: 74,945,831 R450H probably damaging Het
Lrp3 T A 7: 35,203,410 S504C probably damaging Het
Mrps9 T G 1: 42,901,094 probably benign Het
Nlgn1 A G 3: 25,434,392 V564A probably damaging Het
Ntf3 T C 6: 126,102,175 T110A probably benign Het
Pkd1l1 T A 11: 8,909,929 I560F probably damaging Het
Prepl T C 17: 85,081,154 T174A probably benign Het
Ptprg A T 14: 12,122,002 T289S possibly damaging Het
Rab11fip2 T C 19: 59,935,781 T222A probably damaging Het
Rhbdd3 G T 11: 5,099,460 probably benign Het
Sept4 C A 11: 87,588,772 D239E probably damaging Het
Shprh A G 10: 11,207,860 probably benign Het
Slc3a1 T A 17: 85,060,878 W525R probably damaging Het
Trim75 A G 8: 64,982,764 S345P probably damaging Het
Usp5 C T 6: 124,824,938 E72K possibly damaging Het
Vmn1r225 T A 17: 20,502,975 M226K probably benign Het
Zbtb9 C T 17: 26,973,879 T86I probably benign Het
Other mutations in Wnk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wnk4 APN 11 101268748 missense possibly damaging 0.47
IGL00535:Wnk4 APN 11 101264349 missense probably damaging 1.00
IGL01401:Wnk4 APN 11 101276683 splice site probably benign
IGL01931:Wnk4 APN 11 101268484 missense possibly damaging 0.94
IGL01977:Wnk4 APN 11 101265414 missense probably damaging 1.00
IGL02165:Wnk4 APN 11 101275291 unclassified probably benign
IGL02197:Wnk4 APN 11 101263957 missense probably damaging 1.00
IGL02457:Wnk4 APN 11 101269563 splice site probably benign
IGL02963:Wnk4 APN 11 101276213 unclassified probably benign
Caught_dead UTSW 11 101264330 missense probably damaging 1.00
mortification UTSW 11 101263894 makesense probably null
shame UTSW 11 101262856 missense probably damaging 1.00
R0066:Wnk4 UTSW 11 101265435 missense probably damaging 1.00
R0317:Wnk4 UTSW 11 101268804 missense probably benign 0.01
R0628:Wnk4 UTSW 11 101275023 missense probably benign 0.10
R0630:Wnk4 UTSW 11 101265386 missense probably damaging 1.00
R0710:Wnk4 UTSW 11 101274106 missense probably benign 0.22
R1290:Wnk4 UTSW 11 101276340 unclassified probably benign
R1482:Wnk4 UTSW 11 101269636 missense probably damaging 0.99
R1775:Wnk4 UTSW 11 101276340 unclassified probably benign
R2005:Wnk4 UTSW 11 101263890 missense probably damaging 1.00
R2229:Wnk4 UTSW 11 101275641 unclassified probably benign
R2258:Wnk4 UTSW 11 101275035 missense probably damaging 0.98
R2323:Wnk4 UTSW 11 101268481 missense probably damaging 0.99
R3081:Wnk4 UTSW 11 101276891 splice site probably benign
R3763:Wnk4 UTSW 11 101269288 missense probably benign 0.00
R4447:Wnk4 UTSW 11 101268451 missense possibly damaging 0.65
R4614:Wnk4 UTSW 11 101274111 missense probably benign 0.00
R4751:Wnk4 UTSW 11 101276362 unclassified probably benign
R4948:Wnk4 UTSW 11 101268281 missense probably damaging 1.00
R5067:Wnk4 UTSW 11 101262856 missense probably damaging 1.00
R5073:Wnk4 UTSW 11 101261188 missense probably damaging 1.00
R5107:Wnk4 UTSW 11 101275538 unclassified probably benign
R5181:Wnk4 UTSW 11 101265377 missense probably damaging 0.96
R5205:Wnk4 UTSW 11 101265138 missense possibly damaging 0.89
R5252:Wnk4 UTSW 11 101268748 missense possibly damaging 0.47
R5273:Wnk4 UTSW 11 101263869 missense probably damaging 1.00
R5293:Wnk4 UTSW 11 101275197 unclassified probably benign
R5609:Wnk4 UTSW 11 101275636 unclassified probably benign
R5915:Wnk4 UTSW 11 101263894 makesense probably null
R5931:Wnk4 UTSW 11 101261221 missense probably damaging 0.99
R6126:Wnk4 UTSW 11 101276348 unclassified probably benign
R6164:Wnk4 UTSW 11 101275068 missense possibly damaging 0.56
R6191:Wnk4 UTSW 11 101264330 missense probably damaging 1.00
R6267:Wnk4 UTSW 11 101273998 missense probably damaging 1.00
R6274:Wnk4 UTSW 11 101265431 missense probably damaging 1.00
R6296:Wnk4 UTSW 11 101273998 missense probably damaging 1.00
R7132:Wnk4 UTSW 11 101261200 missense probably benign 0.22
R7251:Wnk4 UTSW 11 101265153 missense possibly damaging 0.70
R7352:Wnk4 UTSW 11 101264418 missense probably damaging 1.00
R7404:Wnk4 UTSW 11 101268492 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGCCAGACTCTAGGTGGAG -3'
(R):5'- GGCCAAAGCATCTTCAGAGTC -3'

Sequencing Primer
(F):5'- CCAGACTCTAGGTGGAGAATCTGTTC -3'
(R):5'- AAGCATCTTCAGAGTCGCCCTG -3'
Posted On2015-06-10