Incidental Mutation 'R4196:Elp3'
ID318575
Institutional Source Beutler Lab
Gene Symbol Elp3
Ensembl Gene ENSMUSG00000022031
Gene Nameelongator acetyltransferase complex subunit 3
SynonymsKAT9, 2610507P14Rik
MMRRC Submission 041027-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.889) question?
Stock #R4196 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location65530449-65593075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65548002 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 450 (L450P)
Ref Sequence ENSEMBL: ENSMUSP00000153462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022609] [ENSMUST00000224743] [ENSMUST00000225355]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022609
AA Change: L469P

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022609
Gene: ENSMUSG00000022031
AA Change: L469P

DomainStartEndE-ValueType
Elp3 108 370 1.36e-37 SMART
Blast:Elp3 387 431 2e-19 BLAST
Pfam:Acetyltransf_1 460 555 1.1e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224743
AA Change: L450P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000225355
AA Change: L450P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.646 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ELP3 is the catalytic subunit of the histone acetyltransferase elongator complex, which contributes to transcript elongation and also regulates the maturation of projection neurons (Creppe et al., 2009 [PubMed 19185337]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Embryos homozygous for a null gene trap mutation show severe growth retardation and die prior to E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,263,556 probably benign Het
Acmsd T G 1: 127,749,194 L152R probably damaging Het
Ankle2 A G 5: 110,244,543 K472E possibly damaging Het
Aup1 T C 6: 83,055,230 V126A probably damaging Het
Baz1a T C 12: 54,911,415 Y1014C probably damaging Het
Bcl9 A T 3: 97,216,368 probably benign Het
Cnot2 A T 10: 116,501,304 N221K possibly damaging Het
Col19a1 G A 1: 24,534,052 S213L unknown Het
Eif4enif1 T C 11: 3,243,186 V675A possibly damaging Het
Erbb4 C T 1: 68,343,855 D328N possibly damaging Het
Fbll1 T A 11: 35,797,872 H188L possibly damaging Het
Frem2 A G 3: 53,539,268 F2360L possibly damaging Het
Gm2396 A G 9: 88,917,662 noncoding transcript Het
Gulo G T 14: 65,988,253 P375T possibly damaging Het
Hspd1 T C 1: 55,086,909 M11V probably benign Het
Ikbkap A T 4: 56,755,353 N1295K probably damaging Het
Itgav A G 2: 83,768,327 T243A probably benign Het
Lipg C T 18: 74,945,831 R450H probably damaging Het
Lrp3 T A 7: 35,203,410 S504C probably damaging Het
Mrps9 T G 1: 42,901,094 probably benign Het
Nlgn1 A G 3: 25,434,392 V564A probably damaging Het
Ntf3 T C 6: 126,102,175 T110A probably benign Het
Pkd1l1 T A 11: 8,909,929 I560F probably damaging Het
Prepl T C 17: 85,081,154 T174A probably benign Het
Ptprg A T 14: 12,122,002 T289S possibly damaging Het
Rab11fip2 T C 19: 59,935,781 T222A probably damaging Het
Rhbdd3 G T 11: 5,099,460 probably benign Het
Sept4 C A 11: 87,588,772 D239E probably damaging Het
Shprh A G 10: 11,207,860 probably benign Het
Slc3a1 T A 17: 85,060,878 W525R probably damaging Het
Trim75 A G 8: 64,982,764 S345P probably damaging Het
Usp5 C T 6: 124,824,938 E72K possibly damaging Het
Vmn1r225 T A 17: 20,502,975 M226K probably benign Het
Wnk4 T A 11: 101,269,631 V697E probably damaging Het
Zbtb9 C T 17: 26,973,879 T86I probably benign Het
Other mutations in Elp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02477:Elp3 APN 14 65563311 missense probably benign
R0052:Elp3 UTSW 14 65531526 makesense probably null
R0333:Elp3 UTSW 14 65590593 missense probably benign 0.05
R0513:Elp3 UTSW 14 65563246 splice site probably null
R0980:Elp3 UTSW 14 65577953 missense probably damaging 1.00
R1137:Elp3 UTSW 14 65547921 missense probably damaging 0.99
R1259:Elp3 UTSW 14 65547939 missense probably damaging 0.96
R1378:Elp3 UTSW 14 65592931 missense probably benign
R1722:Elp3 UTSW 14 65551397 missense probably benign 0.02
R1789:Elp3 UTSW 14 65547919 missense probably damaging 1.00
R3843:Elp3 UTSW 14 65565483 splice site probably null
R4125:Elp3 UTSW 14 65560181 missense possibly damaging 0.64
R4400:Elp3 UTSW 14 65548090 missense possibly damaging 0.89
R4420:Elp3 UTSW 14 65580791 missense probably damaging 1.00
R4516:Elp3 UTSW 14 65547877 missense possibly damaging 0.46
R4764:Elp3 UTSW 14 65582929 missense probably damaging 1.00
R4838:Elp3 UTSW 14 65547864 critical splice donor site probably null
R5052:Elp3 UTSW 14 65577940 missense probably damaging 1.00
R5111:Elp3 UTSW 14 65560236 missense probably damaging 1.00
R5665:Elp3 UTSW 14 65551402 missense possibly damaging 0.80
R5702:Elp3 UTSW 14 65577982 missense probably damaging 1.00
R5754:Elp3 UTSW 14 65547990 missense probably damaging 1.00
R5927:Elp3 UTSW 14 65582177 missense probably damaging 1.00
R5999:Elp3 UTSW 14 65531540 missense probably benign 0.01
R6378:Elp3 UTSW 14 65592971 nonsense probably null
R6384:Elp3 UTSW 14 65560211 missense probably damaging 1.00
R6601:Elp3 UTSW 14 65547039 makesense probably null
Predicted Primers PCR Primer
(F):5'- AACATGGAGAAGGACTGCCC -3'
(R):5'- TGTGCTACTTGAGAGGAGGC -3'

Sequencing Primer
(F):5'- TGGAGAAGGACTGCCCCAAAAC -3'
(R):5'- GTTCCTAGCTGAACATTAGCCTAAAC -3'
Posted On2015-06-10