Incidental Mutation 'R4196:Lipg'
ID318581
Institutional Source Beutler Lab
Gene Symbol Lipg
Ensembl Gene ENSMUSG00000053846
Gene Namelipase, endothelial
Synonymsendothelial lipase, EL, mEDL, 3110013K01Rik
MMRRC Submission 041027-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R4196 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location74939322-74961263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74945831 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 450 (R450H)
Ref Sequence ENSEMBL: ENSMUSP00000066536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066532]
Predicted Effect probably damaging
Transcript: ENSMUST00000066532
AA Change: R450H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066536
Gene: ENSMUSG00000053846
AA Change: R450H

DomainStartEndE-ValueType
Pfam:Lipase 20 344 3.1e-108 PFAM
LH2 347 483 5.66e-6 SMART
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has substantial phospholipase activity and may be involved in lipoprotein metabolism and vascular biology. This protein is designated a member of the TG lipase family by its sequence and characteristic lid region which provides substrate specificity for enzymes of the TG lipase family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased circulating total cholesterol and HDL as well as decreased monocyte binding to vascular endothelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,263,556 probably benign Het
Acmsd T G 1: 127,749,194 L152R probably damaging Het
Ankle2 A G 5: 110,244,543 K472E possibly damaging Het
Aup1 T C 6: 83,055,230 V126A probably damaging Het
Baz1a T C 12: 54,911,415 Y1014C probably damaging Het
Bcl9 A T 3: 97,216,368 probably benign Het
Cnot2 A T 10: 116,501,304 N221K possibly damaging Het
Col19a1 G A 1: 24,534,052 S213L unknown Het
Eif4enif1 T C 11: 3,243,186 V675A possibly damaging Het
Elp3 A G 14: 65,548,002 L450P probably damaging Het
Erbb4 C T 1: 68,343,855 D328N possibly damaging Het
Fbll1 T A 11: 35,797,872 H188L possibly damaging Het
Frem2 A G 3: 53,539,268 F2360L possibly damaging Het
Gm2396 A G 9: 88,917,662 noncoding transcript Het
Gulo G T 14: 65,988,253 P375T possibly damaging Het
Hspd1 T C 1: 55,086,909 M11V probably benign Het
Ikbkap A T 4: 56,755,353 N1295K probably damaging Het
Itgav A G 2: 83,768,327 T243A probably benign Het
Lrp3 T A 7: 35,203,410 S504C probably damaging Het
Mrps9 T G 1: 42,901,094 probably benign Het
Nlgn1 A G 3: 25,434,392 V564A probably damaging Het
Ntf3 T C 6: 126,102,175 T110A probably benign Het
Pkd1l1 T A 11: 8,909,929 I560F probably damaging Het
Prepl T C 17: 85,081,154 T174A probably benign Het
Ptprg A T 14: 12,122,002 T289S possibly damaging Het
Rab11fip2 T C 19: 59,935,781 T222A probably damaging Het
Rhbdd3 G T 11: 5,099,460 probably benign Het
Sept4 C A 11: 87,588,772 D239E probably damaging Het
Shprh A G 10: 11,207,860 probably benign Het
Slc3a1 T A 17: 85,060,878 W525R probably damaging Het
Trim75 A G 8: 64,982,764 S345P probably damaging Het
Usp5 C T 6: 124,824,938 E72K possibly damaging Het
Vmn1r225 T A 17: 20,502,975 M226K probably benign Het
Wnk4 T A 11: 101,269,631 V697E probably damaging Het
Zbtb9 C T 17: 26,973,879 T86I probably benign Het
Other mutations in Lipg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Lipg APN 18 74947971 critical splice donor site probably null
IGL02340:Lipg APN 18 74960875 splice site probably null
IGL02804:Lipg APN 18 74949088 missense probably damaging 0.98
listube UTSW 18 74957236 missense probably benign 0.00
R0094:Lipg UTSW 18 74945846 missense probably benign 0.14
R0172:Lipg UTSW 18 74948174 missense possibly damaging 0.94
R0316:Lipg UTSW 18 74960941 missense probably benign 0.01
R0535:Lipg UTSW 18 74954220 missense probably damaging 1.00
R0567:Lipg UTSW 18 74957369 missense probably benign 0.01
R1171:Lipg UTSW 18 74945823 missense possibly damaging 0.71
R1554:Lipg UTSW 18 74948047 missense probably damaging 1.00
R1611:Lipg UTSW 18 74948059 missense possibly damaging 0.81
R1916:Lipg UTSW 18 74960937 missense probably benign 0.00
R2125:Lipg UTSW 18 74945885 missense probably benign
R4629:Lipg UTSW 18 74948036 nonsense probably null
R5186:Lipg UTSW 18 74960938 missense probably benign 0.00
R5424:Lipg UTSW 18 74954253 missense probably damaging 1.00
R5708:Lipg UTSW 18 74955434 missense possibly damaging 0.49
R6416:Lipg UTSW 18 74957236 missense probably benign 0.00
R6493:Lipg UTSW 18 74948024 missense probably damaging 0.99
R6601:Lipg UTSW 18 74948204 missense probably benign
R7199:Lipg UTSW 18 74955584 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTTTCCAGAAGCCCTTATTTGG -3'
(R):5'- GAATGAGATCAGCCTCGGTC -3'

Sequencing Primer
(F):5'- GGAGTCATAGTCCTTGCACAGTCAG -3'
(R):5'- TCTCACCTTGCAGAGTGGAG -3'
Posted On2015-06-10