Incidental Mutation 'R4197:Ptpn21'
ID318606
Institutional Source Beutler Lab
Gene Symbol Ptpn21
Ensembl Gene ENSMUSG00000021009
Gene Nameprotein tyrosine phosphatase, non-receptor type 21
SynonymsPTPD1, PTPRL10
MMRRC Submission 041028-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.550) question?
Stock #R4197 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location98676741-98737405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 98680138 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1020 (H1020Q)
Ref Sequence ENSEMBL: ENSMUSP00000126975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085116] [ENSMUST00000170188] [ENSMUST00000221148] [ENSMUST00000221535] [ENSMUST00000221932]
Predicted Effect probably damaging
Transcript: ENSMUST00000085116
AA Change: H1020Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000082197
Gene: ENSMUSG00000021009
AA Change: H1020Q

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170188
AA Change: H1020Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126975
Gene: ENSMUSG00000021009
AA Change: H1020Q

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221148
Predicted Effect probably benign
Transcript: ENSMUST00000221535
Predicted Effect probably benign
Transcript: ENSMUST00000221932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223321
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain, similar to cytoskeletal- associated proteins including band 4.1, ezrin, merlin, and radixin. This PTP was shown to specially interact with BMX/ETK, a member of Tec tyrosine kinase family characterized by a multimodular structures including PH, SH3, and SH2 domains. The interaction of this PTP with BMX kinase was found to increase the activation of STAT3, but not STAT2 kinase. Studies of the similar gene in mice suggested the possible roles of this PTP in liver regeneration and spermatogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik G A 11: 103,201,140 S94L probably benign Het
BC049730 A G 7: 24,713,694 D146G probably benign Het
Ccno G A 13: 112,989,069 C189Y probably damaging Het
Cd36 T A 5: 17,813,088 D209V probably damaging Het
Depdc5 T A 5: 32,991,203 L1561Q possibly damaging Het
Dhx34 G T 7: 16,203,726 H777N probably damaging Het
Dlat T C 9: 50,636,526 T610A probably damaging Het
Fip1l1 T A 5: 74,535,736 D19E probably damaging Het
Gm5699 T A 1: 30,998,645 noncoding transcript Het
Grin2a A C 16: 9,761,967 F144C probably damaging Het
Klhl18 A T 9: 110,429,944 probably null Het
Klhl31 T C 9: 77,650,809 V269A probably damaging Het
Mmel1 T C 4: 154,893,304 I594T probably damaging Het
Myo9a T A 9: 59,894,866 S1913T probably benign Het
Olfr2 T C 7: 107,001,038 D274G probably damaging Het
Pcdhb14 A G 18: 37,448,305 K155E probably benign Het
Pdcd10 A T 3: 75,517,592 N189K possibly damaging Het
Pde3b T G 7: 114,530,872 probably benign Het
Plxnb2 T C 15: 89,157,018 N1775S probably damaging Het
Polr2a T C 11: 69,735,336 S1625G unknown Het
Rad23b C T 4: 55,385,455 P331S probably damaging Het
Scel A T 14: 103,599,400 N475Y probably damaging Het
Sema5a A G 15: 32,618,918 T531A probably benign Het
Sf3b3 A T 8: 110,821,565 L679Q probably damaging Het
Sipa1l3 A T 7: 29,400,813 D10E possibly damaging Het
Slc44a4 G A 17: 34,918,252 V84I probably benign Het
Slco5a1 G T 1: 12,894,516 S512R probably damaging Het
Sv2c A T 13: 95,978,128 F517I probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tnfsf11 A T 14: 78,284,312 D152E probably benign Het
Trav13n-4 C T 14: 53,363,921 T49I probably benign Het
Ttn T C 2: 76,886,078 probably benign Het
Usp34 T C 11: 23,444,189 S2261P probably damaging Het
Vmn2r87 G A 10: 130,479,910 P96S possibly damaging Het
Xrcc6 A G 15: 82,029,224 M353V probably benign Het
Other mutations in Ptpn21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ptpn21 APN 12 98680468 missense probably damaging 1.00
IGL00576:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00577:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00580:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00583:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00773:Ptpn21 APN 12 98688313 missense probably benign 0.00
IGL00780:Ptpn21 APN 12 98680371 missense probably damaging 1.00
IGL01516:Ptpn21 APN 12 98715189 missense probably damaging 1.00
IGL01616:Ptpn21 APN 12 98680013 missense probably damaging 1.00
IGL01939:Ptpn21 APN 12 98689161 missense probably damaging 0.96
IGL02237:Ptpn21 APN 12 98705092 critical splice donor site probably null
IGL02512:Ptpn21 APN 12 98679392 missense probably benign 0.00
IGL02852:Ptpn21 APN 12 98715195 critical splice acceptor site probably null
IGL02894:Ptpn21 APN 12 98689632 splice site probably benign
IGL03024:Ptpn21 APN 12 98680056 missense probably benign
IGL03220:Ptpn21 APN 12 98678623 missense probably damaging 1.00
R0144:Ptpn21 UTSW 12 98688609 missense probably benign 0.01
R0472:Ptpn21 UTSW 12 98704240 splice site probably benign
R0675:Ptpn21 UTSW 12 98688216 missense probably benign 0.16
R0771:Ptpn21 UTSW 12 98689080 missense probably damaging 1.00
R1434:Ptpn21 UTSW 12 98688590 missense probably damaging 1.00
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1837:Ptpn21 UTSW 12 98733626 missense probably damaging 0.99
R1897:Ptpn21 UTSW 12 98680405 unclassified probably null
R2048:Ptpn21 UTSW 12 98689526 missense possibly damaging 0.94
R2376:Ptpn21 UTSW 12 98688314 missense possibly damaging 0.62
R3709:Ptpn21 UTSW 12 98688541 missense probably benign
R4283:Ptpn21 UTSW 12 98733475 missense probably damaging 0.99
R4368:Ptpn21 UTSW 12 98678593 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98688248 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98715060 missense probably damaging 0.98
R4703:Ptpn21 UTSW 12 98679392 missense probably benign 0.00
R4737:Ptpn21 UTSW 12 98708844 missense probably benign 0.03
R4829:Ptpn21 UTSW 12 98689296 missense probably damaging 1.00
R4926:Ptpn21 UTSW 12 98715195 critical splice acceptor site probably null
R4974:Ptpn21 UTSW 12 98680103 missense probably damaging 1.00
R5022:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5057:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5395:Ptpn21 UTSW 12 98715117 missense probably damaging 1.00
R5608:Ptpn21 UTSW 12 98688777 missense probably benign 0.00
R5741:Ptpn21 UTSW 12 98679289 missense probably damaging 1.00
R5785:Ptpn21 UTSW 12 98682550 missense probably damaging 0.99
R5959:Ptpn21 UTSW 12 98708889 splice site probably null
R5968:Ptpn21 UTSW 12 98710890 missense probably damaging 1.00
R5984:Ptpn21 UTSW 12 98689076 missense probably damaging 1.00
R6005:Ptpn21 UTSW 12 98678552 makesense probably null
R6181:Ptpn21 UTSW 12 98699999 missense probably damaging 0.99
R6226:Ptpn21 UTSW 12 98680116 missense probably benign 0.24
R6226:Ptpn21 UTSW 12 98715172 missense probably damaging 1.00
R6317:Ptpn21 UTSW 12 98689262 missense probably damaging 1.00
R6370:Ptpn21 UTSW 12 98689034 missense possibly damaging 0.86
R6485:Ptpn21 UTSW 12 98698872 nonsense probably null
R6894:Ptpn21 UTSW 12 98715181 missense probably damaging 1.00
R7122:Ptpn21 UTSW 12 98688912 missense probably damaging 0.99
R7232:Ptpn21 UTSW 12 98688737 missense probably benign 0.17
R7289:Ptpn21 UTSW 12 98704191 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TTTGAGGTCTTCGGGACAGC -3'
(R):5'- AGAAGAGGTGAGTGTCTGTTCC -3'

Sequencing Primer
(F):5'- TCTTCGGGACAGCCGTGTTC -3'
(R):5'- TTCCAAGTCTCCAGAGAGCTG -3'
Posted On2015-06-10