Incidental Mutation 'R4197:Tnfsf11'

• ID: 318610
• Institutional Source: Beutler Lab
• Gene Symbol: Tnfsf11
• Ensembl Gene: ENSMUSG00000022015
• Gene Name: tumor necrosis factor (ligand) superfamily, member 11
• Synonyms: Ly109l, Trance, osteoclast differentiation factor, RANKL, OPGL, OPGL, ODF
• MMRRC Submission: 041028-MU
• Essential gene?: Possibly non essential (E-score: 0.478)
• Stock #: R4197 (G1)
• Quality Score: 225
• Status: Validated
• Chromosome: 14
• Chromosomal Location: 78514886-78545483 bp(-) (GRCm39)
• Type of Mutation: missense
• DNA Base Change (assembly): A to T at 78521752 bp (GRCm39)
• Zygosity: Heterozygous
• Amino Acid Change: Aspartic acid to Glutamic Acid at position 152 (D152E)
• Ref Sequence: ENSEMBL: ENSMUSP00000022592
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000022592]
• AlphaFold: O35235
• PDB Structure: CRYSTAL STRUCTURE OF THE EXTRACELLULAR DOMAIN OF MOUSE RANK LIGAND [X-RAY DIFFRACTION] ; CRYSTAL STRUCTURE OF TRANCE/RANKL CYTOKINE. [X-RAY DIFFRACTION] ; Mouse RANKL Structure at 1.9A Resolution [X-RAY DIFFRACTION] ; Crystal structure of mouse RANKL-RANK complex [X-RAY DIFFRACTION] ; Crystal structure of extracellular domains of mouse RANK-RANKL complex [X-RAY DIFFRACTION] ; Crystal structure of mouse RANKL-OPG complex [X-RAY DIFFRACTION] ; Crystal Structure of mouse RANK bound to RANKL [X-RAY DIFFRACTION]
• Predicted Effect: probably benign; Transcript: ENSMUST00000022592; AA Change: D152E; PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
• SMART Domains: Protein: ENSMUSP00000022592; Gene: ENSMUSG00000022015; AA Change: D152E

Domain	Start	End	E-Value	Type
low complexity region	32	46	N/A	INTRINSIC
transmembrane domain	49	71	N/A	INTRINSIC
TNF	163	312	7.37e-58	SMART

• Meta Mutation Damage Score: 0.0610
• Coding Region Coverage:
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
• Validation Efficiency: 100% (42/42)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor (TNF) cytokine family which is a ligand for osteoprotegerin and functions as a key factor for osteoclast differentiation and activation. This protein was shown to be a dentritic cell survival factor and is involved in the regulation of T cell-dependent immune response. T cell activation was reported to induce expression of this gene and lead to an increase of osteoclastogenesis and bone loss. This protein was shown to activate antiapoptotic kinase AKT/PKB through a signaling complex involving SRC kinase and tumor necrosis factor receptor-associated factor (TRAF) 6, which indicated this protein may have a role in the regulation of cell apoptosis. Targeted disruption of the related gene in mice led to severe osteopetrosis and a lack of osteoclasts. The deficient mice exhibited defects in early differentiation of T and B lymphocytes, and failed to form lobulo-alveolar mammary structures during pregnancy. Two alternatively spliced transcript variants have been found. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a null allele exhibit a failure of tooth eruption, osteopetrosis, failure to lactate and arrested alveolar bud differentiation during pregnancy. [provided by MGI curators]
• Posted On: 2015-06-10

Predicted Primers

PCR Primer
(F):5'- AGGGTTCAACTGAAGGGTTTACC -3'
(R):5'- TTCCCGCTGCTTTACACAAAG -3'

Sequencing Primer
(F):5'- ACCTCCTCCTCATGGTTTAGAAGG -3'
(R):5'- CGCTGCTTTACACAAAGAATGAG -3'