Incidental Mutation 'R4198:Map2'
ID318620
Institutional Source Beutler Lab
Gene Symbol Map2
Ensembl Gene ENSMUSG00000015222
Gene Namemicrotubule-associated protein 2
Synonymsrepro4, MAP-2, Mtap2, G1-397-34
MMRRC Submission 041640-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R4198 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location66175273-66442583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66425298 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 128 (R128C)
Ref Sequence ENSEMBL: ENSMUSP00000134518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024639] [ENSMUST00000077355] [ENSMUST00000114012] [ENSMUST00000114013] [ENSMUST00000114015] [ENSMUST00000114017] [ENSMUST00000114018] [ENSMUST00000172886] [ENSMUST00000173778] [ENSMUST00000173800]
Predicted Effect probably damaging
Transcript: ENSMUST00000024639
AA Change: R255C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024639
Gene: ENSMUSG00000015222
AA Change: R255C

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077355
AA Change: R255C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076577
Gene: ENSMUSG00000015222
AA Change: R255C

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114012
AA Change: R254C

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109645
Gene: ENSMUSG00000015222
AA Change: R254C

DomainStartEndE-ValueType
low complexity region 133 140 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 228 250 N/A INTRINSIC
Pfam:Tubulin-binding 299 330 2.1e-18 PFAM
Pfam:Tubulin-binding 331 361 9.1e-20 PFAM
Pfam:Tubulin-binding 362 393 1.7e-17 PFAM
low complexity region 421 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114013
AA Change: R1616C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109646
Gene: ENSMUSG00000015222
AA Change: R1616C

DomainStartEndE-ValueType
Pfam:RII_binding_1 86 103 1.2e-5 PFAM
low complexity region 120 141 N/A INTRINSIC
Pfam:MAP2_projctn 376 1510 N/A PFAM
low complexity region 1543 1557 N/A INTRINSIC
low complexity region 1567 1583 N/A INTRINSIC
low complexity region 1590 1612 N/A INTRINSIC
Pfam:Tubulin-binding 1662 1692 1.7e-13 PFAM
Pfam:Tubulin-binding 1693 1723 5.8e-18 PFAM
Pfam:Tubulin-binding 1724 1755 5.9e-18 PFAM
low complexity region 1783 1796 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114015
AA Change: R255C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109648
Gene: ENSMUSG00000015222
AA Change: R255C

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114017
AA Change: R255C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109650
Gene: ENSMUSG00000015222
AA Change: R255C

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114018
AA Change: R255C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109651
Gene: ENSMUSG00000015222
AA Change: R255C

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151423
Predicted Effect probably damaging
Transcript: ENSMUST00000172886
AA Change: R185C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133446
Gene: ENSMUSG00000015222
AA Change: R185C

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 107 3.9e-54 PFAM
low complexity region 112 126 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
low complexity region 159 181 N/A INTRINSIC
Pfam:Tubulin-binding 230 261 1.4e-18 PFAM
Pfam:Tubulin-binding 262 292 1.4e-19 PFAM
Pfam:Tubulin-binding 293 323 6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173778
AA Change: R230C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134651
Gene: ENSMUSG00000015222
AA Change: R230C

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 124 4.8e-84 PFAM
low complexity region 157 171 N/A INTRINSIC
low complexity region 181 197 N/A INTRINSIC
low complexity region 204 226 N/A INTRINSIC
Pfam:Tubulin-binding 275 306 1.6e-18 PFAM
Pfam:Tubulin-binding 307 337 1.6e-19 PFAM
Pfam:Tubulin-binding 338 368 7e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173800
AA Change: R128C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134518
Gene: ENSMUSG00000015222
AA Change: R128C

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 23 2.2e-11 PFAM
low complexity region 55 69 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 102 124 N/A INTRINSIC
Pfam:Tubulin-binding 173 204 8.7e-19 PFAM
Pfam:Tubulin-binding 205 235 3.8e-20 PFAM
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The products of similar genes in rat and mouse are neuron-specific cytoskeletal proteins that are enriched in dentrites, implicating a role in determining and stabilizing dentritic shape during neuron development. A number of alternatively spliced variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered contextual memory. Mice homozygous for another knock-out allele display decreased body weight, altered microtubule density and organization in Purkinje cell dendrites, and reduced dendritic length inhippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 G A 1: 58,085,607 M1002I probably benign Het
Ap2b1 C A 11: 83,342,603 Q481K probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Atp10a A G 7: 58,813,686 D989G probably damaging Het
Ccny G A 18: 9,332,928 T201I probably damaging Het
Cdca5 T C 19: 6,090,352 V181A possibly damaging Het
Ces1g A G 8: 93,305,868 I488T probably benign Het
Csmd2 A G 4: 128,510,924 T2368A probably benign Het
Cux1 T A 5: 136,286,848 I1113F probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Fyco1 T C 9: 123,826,634 N1020D probably benign Het
Gprc5c T G 11: 114,863,860 L121R probably damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Kera T C 10: 97,612,973 *352Q probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnpk T C 2: 74,569,109 E30G probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr1381 G A 11: 49,552,634 V296M possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olfr97 T A 17: 37,232,134 M79L probably benign Het
Ror2 A G 13: 53,110,644 M792T probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Serpinb9d A G 13: 33,202,965 I339V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Snx20 A G 8: 88,627,598 V168A possibly damaging Het
Sowaha T C 11: 53,478,568 E447G possibly damaging Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Stx19 G T 16: 62,822,676 C285F possibly damaging Het
Syp A G X: 7,639,927 probably null Het
Tbkbp1 C T 11: 97,149,068 probably null Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp316 T C 5: 143,254,471 M598V probably benign Het
Zhx2 A G 15: 57,821,729 I165V probably benign Het
Other mutations in Map2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Map2 APN 1 66425331 missense probably damaging 1.00
IGL02135:Map2 APN 1 66380761 nonsense probably null
IGL02526:Map2 APN 1 66380717 missense possibly damaging 0.94
Annas UTSW 1 66433597 critical splice donor site probably null
calliope UTSW 1 66425298 missense probably damaging 1.00
ruby_throat UTSW 1 66414884 missense possibly damaging 0.67
E0370:Map2 UTSW 1 66416724 unclassified probably benign
R0067:Map2 UTSW 1 66413163 missense probably benign 0.04
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0268:Map2 UTSW 1 66380722 nonsense probably null
R0302:Map2 UTSW 1 66414828 missense probably benign 0.15
R0305:Map2 UTSW 1 66413094 missense probably benign 0.00
R0409:Map2 UTSW 1 66433580 missense probably damaging 1.00
R0561:Map2 UTSW 1 66425497 missense probably damaging 1.00
R0674:Map2 UTSW 1 66413202 missense probably damaging 1.00
R0738:Map2 UTSW 1 66425189 splice site probably benign
R0893:Map2 UTSW 1 66380768 missense probably damaging 1.00
R1305:Map2 UTSW 1 66425395 missense probably damaging 1.00
R1534:Map2 UTSW 1 66413180 missense probably benign 0.33
R1632:Map2 UTSW 1 66415086 missense possibly damaging 0.60
R1682:Map2 UTSW 1 66415622 unclassified probably null
R1774:Map2 UTSW 1 66414074 missense probably damaging 1.00
R2014:Map2 UTSW 1 66416136 missense possibly damaging 0.55
R2017:Map2 UTSW 1 66412799 missense probably damaging 1.00
R2050:Map2 UTSW 1 66414314 missense probably damaging 0.98
R2093:Map2 UTSW 1 66399440 missense probably damaging 1.00
R2214:Map2 UTSW 1 66420186 missense probably damaging 0.99
R2284:Map2 UTSW 1 66414068 missense probably damaging 1.00
R3011:Map2 UTSW 1 66414612 missense probably damaging 1.00
R3105:Map2 UTSW 1 66433597 critical splice donor site probably null
R3708:Map2 UTSW 1 66416555 unclassified probably benign
R3709:Map2 UTSW 1 66415856 nonsense probably null
R3729:Map2 UTSW 1 66412446 missense possibly damaging 0.80
R3760:Map2 UTSW 1 66438918 missense probably damaging 1.00
R3788:Map2 UTSW 1 66416863 missense probably damaging 0.99
R3789:Map2 UTSW 1 66416863 missense probably damaging 0.99
R4003:Map2 UTSW 1 66415740 missense probably damaging 1.00
R4120:Map2 UTSW 1 66415904 missense probably damaging 1.00
R4172:Map2 UTSW 1 66413600 missense possibly damaging 0.89
R4200:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4205:Map2 UTSW 1 66425290 missense probably damaging 1.00
R4613:Map2 UTSW 1 66425469 missense probably damaging 1.00
R4700:Map2 UTSW 1 66410637 missense probably damaging 0.96
R4974:Map2 UTSW 1 66413505 missense probably benign 0.15
R5007:Map2 UTSW 1 66413289 missense possibly damaging 0.86
R5039:Map2 UTSW 1 66438796 missense probably damaging 1.00
R5237:Map2 UTSW 1 66439010 unclassified probably benign
R5313:Map2 UTSW 1 66425379 missense probably damaging 1.00
R5455:Map2 UTSW 1 66399391 missense probably damaging 1.00
R5490:Map2 UTSW 1 66413133 missense probably damaging 1.00
R5517:Map2 UTSW 1 66415256 missense probably benign 0.00
R5532:Map2 UTSW 1 66414620 missense probably damaging 1.00
R5583:Map2 UTSW 1 66416037 missense probably damaging 1.00
R5764:Map2 UTSW 1 66414875 missense probably damaging 0.99
R5996:Map2 UTSW 1 66414884 missense possibly damaging 0.67
R6058:Map2 UTSW 1 66415414 missense probably benign 0.05
R6199:Map2 UTSW 1 66425478 missense probably damaging 1.00
R6208:Map2 UTSW 1 66431590 missense probably damaging 1.00
R6276:Map2 UTSW 1 66399419 missense probably damaging 1.00
R6378:Map2 UTSW 1 66415329 missense probably damaging 1.00
R6424:Map2 UTSW 1 66414787 missense possibly damaging 0.67
R6743:Map2 UTSW 1 66415607 missense probably benign 0.04
R6837:Map2 UTSW 1 66414572 missense probably damaging 1.00
R6901:Map2 UTSW 1 66421773 missense possibly damaging 0.94
R6984:Map2 UTSW 1 66415236 missense possibly damaging 0.90
R6989:Map2 UTSW 1 66414906 missense probably benign 0.00
V8831:Map2 UTSW 1 66415845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACTTTGTGTGGGAAGAAGACTAC -3'
(R):5'- ATTCTTCAGGTCCGGCAGTG -3'

Sequencing Primer
(F):5'- TTGTGTGGGAAGAAGACTACCTTAAG -3'
(R):5'- TGGTTGGTTAATAAGCCGAAGC -3'
Posted On2015-06-10