Incidental Mutation 'R4198:Hyou1'
ID 318637
Institutional Source Beutler Lab
Gene Symbol Hyou1
Ensembl Gene ENSMUSG00000032115
Gene Name hypoxia up-regulated 1
Synonyms 140 kDa, Orp150, Cab140, Grp170, CBP-140
MMRRC Submission 041640-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4198 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 44290840-44303662 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 44300156 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 815 (R815H)
Ref Sequence ENSEMBL: ENSMUSP00000123700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066601] [ENSMUST00000159473] [ENSMUST00000160902] [ENSMUST00000161318] [ENSMUST00000162560]
AlphaFold Q9JKR6
Predicted Effect probably damaging
Transcript: ENSMUST00000066601
AA Change: R815H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068594
Gene: ENSMUSG00000032115
AA Change: R815H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 669 1.3e-101 PFAM
Pfam:HSP70 690 814 2.1e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159473
SMART Domains Protein: ENSMUSP00000124177
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:HSP70 38 226 2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160112
Predicted Effect probably damaging
Transcript: ENSMUST00000160902
AA Change: R815H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125594
Gene: ENSMUSG00000032115
AA Change: R815H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161147
Predicted Effect probably damaging
Transcript: ENSMUST00000161318
AA Change: R815H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123700
Gene: ENSMUSG00000032115
AA Change: R815H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161537
Predicted Effect probably benign
Transcript: ENSMUST00000162560
SMART Domains Protein: ENSMUSP00000123749
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 168 6.5e-20 PFAM
Meta Mutation Damage Score 0.1230 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the heat shock protein 70 family. This gene uses alternative transcription start sites. A cis-acting segment found in the 5' UTR is involved in stress-dependent induction, resulting in the accumulation of this protein in the endoplasmic reticulum (ER) under hypoxic conditions. The protein encoded by this gene is thought to play an important role in protein folding and secretion in the ER. Since suppression of the protein is associated with accelerated apoptosis, it is also suggested to have an important cytoprotective role in hypoxia-induced cellular perturbation. This protein has been shown to be up-regulated in tumors, especially in breast tumors, and thus it is associated with tumor invasiveness. This gene also has an alternative translation initiation site, resulting in a protein that lacks the N-terminal signal peptide. This signal peptide-lacking protein, which is only 3 amino acids shorter than the mature protein in the ER, is thought to have a housekeeping function in the cytosol. In rat, this protein localizes to both the ER by a carboxy-terminal peptide sequence and to mitochondria by an amino-terminal targeting signal. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous mice display increased susceptibility to induced neuronal cell death. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 G A 1: 58,124,766 (GRCm39) M1002I probably benign Het
Ap2b1 C A 11: 83,233,429 (GRCm39) Q481K probably damaging Het
Arhgap31 G A 16: 38,444,275 (GRCm39) A194V probably damaging Het
Atp10a A G 7: 58,463,434 (GRCm39) D989G probably damaging Het
Ccny G A 18: 9,332,928 (GRCm39) T201I probably damaging Het
Cdca5 T C 19: 6,140,382 (GRCm39) V181A possibly damaging Het
Ces1g A G 8: 94,032,496 (GRCm39) I488T probably benign Het
Csmd2 A G 4: 128,404,717 (GRCm39) T2368A probably benign Het
Cux1 T A 5: 136,315,702 (GRCm39) I1113F probably damaging Het
Dnah3 C T 7: 119,522,061 (GRCm39) G4033D probably damaging Het
Foxg1 T A 12: 49,432,082 (GRCm39) S272T possibly damaging Het
Fyco1 T C 9: 123,655,699 (GRCm39) N1020D probably benign Het
Gprc5c T G 11: 114,754,686 (GRCm39) L121R probably damaging Het
Kera T C 10: 97,448,835 (GRCm39) *352Q probably null Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Lnpk T C 2: 74,399,453 (GRCm39) E30G probably damaging Het
Map2 C T 1: 66,464,457 (GRCm39) R128C probably damaging Het
Or1i2 A T 10: 78,447,901 (GRCm39) D191E possibly damaging Het
Or1o2 T A 17: 37,543,025 (GRCm39) M79L probably benign Het
Or2y11 G A 11: 49,443,461 (GRCm39) V296M possibly damaging Het
Or51h7 A G 7: 102,591,004 (GRCm39) F260S probably damaging Het
Pabir3 G A X: 52,382,376 (GRCm39) R94H possibly damaging Het
Ror2 A G 13: 53,264,680 (GRCm39) M792T probably benign Het
Serpinb9d A G 13: 33,386,948 (GRCm39) I339V probably benign Het
Serpinb9d A G 13: 33,386,657 (GRCm39) probably null Het
Slc1a1 A G 19: 28,878,852 (GRCm39) K197R probably benign Het
Snx20 A G 8: 89,354,226 (GRCm39) V168A possibly damaging Het
Sowaha T C 11: 53,369,395 (GRCm39) E447G possibly damaging Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 98,110,114 (GRCm39) probably benign Het
Stx19 G T 16: 62,643,039 (GRCm39) C285F possibly damaging Het
Syp A G X: 7,506,166 (GRCm39) probably null Het
Tbkbp1 C T 11: 97,039,894 (GRCm39) probably null Het
Trim29 G T 9: 43,222,677 (GRCm39) E169* probably null Het
Ttll12 T C 15: 83,461,214 (GRCm39) N602D probably damaging Het
Zfp26 T C 9: 20,348,012 (GRCm39) T851A probably benign Het
Zfp316 T C 5: 143,240,226 (GRCm39) M598V probably benign Het
Zhx2 A G 15: 57,685,125 (GRCm39) I165V probably benign Het
Other mutations in Hyou1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Hyou1 APN 9 44,296,443 (GRCm39) missense probably benign 0.02
IGL01660:Hyou1 APN 9 44,292,414 (GRCm39) missense possibly damaging 0.75
IGL01677:Hyou1 APN 9 44,293,309 (GRCm39) missense probably benign 0.21
IGL01903:Hyou1 APN 9 44,292,438 (GRCm39) splice site probably benign
IGL02636:Hyou1 APN 9 44,292,707 (GRCm39) critical splice donor site probably null
IGL02806:Hyou1 APN 9 44,300,180 (GRCm39) nonsense probably null
IGL03401:Hyou1 APN 9 44,296,206 (GRCm39) missense probably damaging 1.00
IGL03410:Hyou1 APN 9 44,299,355 (GRCm39) missense probably benign
ANU74:Hyou1 UTSW 9 44,292,560 (GRCm39) missense possibly damaging 0.79
D3080:Hyou1 UTSW 9 44,295,774 (GRCm39) missense probably damaging 0.97
PIT4378001:Hyou1 UTSW 9 44,302,148 (GRCm39) missense probably benign 0.26
R0408:Hyou1 UTSW 9 44,295,989 (GRCm39) missense probably damaging 1.00
R0422:Hyou1 UTSW 9 44,300,539 (GRCm39) missense probably damaging 1.00
R1116:Hyou1 UTSW 9 44,295,978 (GRCm39) missense probably damaging 1.00
R1581:Hyou1 UTSW 9 44,300,167 (GRCm39) missense probably damaging 1.00
R1640:Hyou1 UTSW 9 44,300,703 (GRCm39) missense probably benign 0.02
R1803:Hyou1 UTSW 9 44,295,479 (GRCm39) nonsense probably null
R2060:Hyou1 UTSW 9 44,292,849 (GRCm39) missense probably benign 0.28
R2180:Hyou1 UTSW 9 44,299,316 (GRCm39) missense probably benign 0.30
R2233:Hyou1 UTSW 9 44,300,388 (GRCm39) missense probably benign 0.44
R2235:Hyou1 UTSW 9 44,300,388 (GRCm39) missense probably benign 0.44
R3950:Hyou1 UTSW 9 44,296,524 (GRCm39) missense probably damaging 1.00
R4200:Hyou1 UTSW 9 44,300,156 (GRCm39) missense probably damaging 1.00
R4363:Hyou1 UTSW 9 44,291,912 (GRCm39) splice site probably null
R4393:Hyou1 UTSW 9 44,293,169 (GRCm39) missense probably damaging 1.00
R4394:Hyou1 UTSW 9 44,293,169 (GRCm39) missense probably damaging 1.00
R4812:Hyou1 UTSW 9 44,298,418 (GRCm39) intron probably benign
R5239:Hyou1 UTSW 9 44,296,560 (GRCm39) missense possibly damaging 0.96
R5648:Hyou1 UTSW 9 44,296,546 (GRCm39) missense probably damaging 0.99
R5818:Hyou1 UTSW 9 44,300,223 (GRCm39) critical splice donor site probably null
R5856:Hyou1 UTSW 9 44,292,641 (GRCm39) missense probably damaging 1.00
R6431:Hyou1 UTSW 9 44,293,322 (GRCm39) critical splice donor site probably null
R6594:Hyou1 UTSW 9 44,300,619 (GRCm39) missense probably benign
R6596:Hyou1 UTSW 9 44,299,052 (GRCm39) missense probably benign 0.00
R6613:Hyou1 UTSW 9 44,293,795 (GRCm39) missense probably damaging 0.99
R6704:Hyou1 UTSW 9 44,292,431 (GRCm39) critical splice donor site probably null
R6849:Hyou1 UTSW 9 44,298,561 (GRCm39) missense probably damaging 0.99
R7494:Hyou1 UTSW 9 44,300,706 (GRCm39) missense probably benign 0.04
R7632:Hyou1 UTSW 9 44,292,433 (GRCm39) splice site probably null
R7711:Hyou1 UTSW 9 44,295,759 (GRCm39) missense possibly damaging 0.91
R8064:Hyou1 UTSW 9 44,296,882 (GRCm39) missense possibly damaging 0.80
R8287:Hyou1 UTSW 9 44,299,430 (GRCm39) missense probably benign 0.26
R9352:Hyou1 UTSW 9 44,300,926 (GRCm39) critical splice donor site probably null
R9385:Hyou1 UTSW 9 44,292,812 (GRCm39) missense probably benign 0.06
X0027:Hyou1 UTSW 9 44,302,153 (GRCm39) missense possibly damaging 0.89
Z1176:Hyou1 UTSW 9 44,299,039 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTGAGATGTGGCAGGCAG -3'
(R):5'- AGTGAAGACCTGGTCCATCTCC -3'

Sequencing Primer
(F):5'- CTTCCAGGGCCAGAGTGAG -3'
(R):5'- CCCCTAGGAGCCAAAGAGG -3'
Posted On 2015-06-10