Incidental Mutation 'R4198:Kera'
ID318640
Institutional Source Beutler Lab
Gene Symbol Kera
Ensembl Gene ENSMUSG00000019932
Gene Namekeratocan
SynonymsSLRR2B, CNA2
MMRRC Submission 041640-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4198 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location97606879-97613692 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 97612973 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 352 (*352Q)
Ref Sequence ENSEMBL: ENSMUSP00000100923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105286]
Predicted Effect probably null
Transcript: ENSMUST00000105286
AA Change: *352Q
SMART Domains Protein: ENSMUSP00000100923
Gene: ENSMUSG00000019932
AA Change: *352Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRRNT 42 76 1.9e-14 SMART
LRR 71 90 2.5e-1 SMART
LRR 121 140 2.1e-1 SMART
LRR 142 161 1.5e0 SMART
LRR 166 191 3.4e-2 SMART
LRR 192 215 2.8e-2 SMART
LRR 213 232 9.2e-1 SMART
Blast:LRR 237 261 4e-8 BLAST
LRR 262 281 6.3e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a keratan sulfate proteoglycan that is involved in corneal transparency. Defects in this gene are a cause of autosomal recessive cornea plana 2 (CNA2).[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have a thinner than normal corneal stroma with thicker collagen fibers which were less regularly packed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 G A 1: 58,085,607 M1002I probably benign Het
Ap2b1 C A 11: 83,342,603 Q481K probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Atp10a A G 7: 58,813,686 D989G probably damaging Het
Ccny G A 18: 9,332,928 T201I probably damaging Het
Cdca5 T C 19: 6,090,352 V181A possibly damaging Het
Ces1g A G 8: 93,305,868 I488T probably benign Het
Csmd2 A G 4: 128,510,924 T2368A probably benign Het
Cux1 T A 5: 136,286,848 I1113F probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Fyco1 T C 9: 123,826,634 N1020D probably benign Het
Gprc5c T G 11: 114,863,860 L121R probably damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnpk T C 2: 74,569,109 E30G probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr1381 G A 11: 49,552,634 V296M possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olfr97 T A 17: 37,232,134 M79L probably benign Het
Ror2 A G 13: 53,110,644 M792T probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Serpinb9d A G 13: 33,202,965 I339V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Snx20 A G 8: 88,627,598 V168A possibly damaging Het
Sowaha T C 11: 53,478,568 E447G possibly damaging Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Stx19 G T 16: 62,822,676 C285F possibly damaging Het
Syp A G X: 7,639,927 probably null Het
Tbkbp1 C T 11: 97,149,068 probably null Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp316 T C 5: 143,254,471 M598V probably benign Het
Zhx2 A G 15: 57,821,729 I165V probably benign Het
Other mutations in Kera
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Kera APN 10 97609077 missense possibly damaging 0.79
R1309:Kera UTSW 10 97609426 missense possibly damaging 0.82
R1830:Kera UTSW 10 97609147 missense probably benign 0.29
R1895:Kera UTSW 10 97609147 missense probably benign 0.29
R1946:Kera UTSW 10 97609147 missense probably benign 0.29
R2365:Kera UTSW 10 97608943 missense probably benign 0.44
R3957:Kera UTSW 10 97612845 missense probably benign
R4624:Kera UTSW 10 97609631 missense probably benign 0.00
R4625:Kera UTSW 10 97609631 missense probably benign 0.00
R4628:Kera UTSW 10 97609631 missense probably benign 0.00
R4629:Kera UTSW 10 97609631 missense probably benign 0.00
R4640:Kera UTSW 10 97612887 missense probably damaging 1.00
R6496:Kera UTSW 10 97612810 missense probably benign
R6767:Kera UTSW 10 97609172 missense possibly damaging 0.92
R6999:Kera UTSW 10 97608952 missense probably damaging 1.00
R7017:Kera UTSW 10 97609077 missense possibly damaging 0.79
R7117:Kera UTSW 10 97612852 missense probably benign
R7519:Kera UTSW 10 97609022 missense not run
Predicted Primers PCR Primer
(F):5'- TGGTCTAGATCTCCATACTCTCTGG -3'
(R):5'- AACTAATACACGTGGCCCCTG -3'

Sequencing Primer
(F):5'- TCTCTCTGCCTCCATAGATGTGAAC -3'
(R):5'- TGTGTGTCACTGACCAGAGCATC -3'
Posted On2015-06-10