Incidental Mutation 'R0394:Coro1a'
ID31866
Institutional Source Beutler Lab
Gene Symbol Coro1a
Ensembl Gene ENSMUSG00000030707
Gene Namecoronin, actin binding protein 1A
SynonymsClabp, Lmb3, coronin 1, p57
MMRRC Submission 038600-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0394 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126699773-126707787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126700640 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 337 (F337L)
Ref Sequence ENSEMBL: ENSMUSP00000134123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032949] [ENSMUST00000106364] [ENSMUST00000106369] [ENSMUST00000130498] [ENSMUST00000131415] [ENSMUST00000135087] [ENSMUST00000142337] [ENSMUST00000144897] [ENSMUST00000173108] [ENSMUST00000173116] [ENSMUST00000205515]
Predicted Effect probably benign
Transcript: ENSMUST00000032949
AA Change: F337L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032949
Gene: ENSMUSG00000030707
AA Change: F337L

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
WD40 120 160 2.42e-7 SMART
WD40 163 204 6.09e-4 SMART
DUF1900 258 392 1.23e-89 SMART
PDB:2AKF|C 430 461 3e-13 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000052145
Predicted Effect probably benign
Transcript: ENSMUST00000106364
AA Change: F337L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101972
Gene: ENSMUSG00000030707
AA Change: F337L

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
WD40 120 160 2.42e-7 SMART
WD40 163 204 6.09e-4 SMART
DUF1900 258 392 1.23e-89 SMART
Pfam:Trimer_CC 410 461 4.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106369
SMART Domains Protein: ENSMUSP00000101977
Gene: ENSMUSG00000047721

DomainStartEndE-ValueType
Pfam:BolA 10 54 4.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126193
Predicted Effect probably benign
Transcript: ENSMUST00000130498
SMART Domains Protein: ENSMUSP00000114873
Gene: ENSMUSG00000047721

DomainStartEndE-ValueType
Pfam:BolA 12 79 1.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131415
SMART Domains Protein: ENSMUSP00000117931
Gene: ENSMUSG00000030707

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
WD40 120 160 2.42e-7 SMART
WD40 163 204 6.09e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133718
Predicted Effect probably benign
Transcript: ENSMUST00000135087
SMART Domains Protein: ENSMUSP00000115960
Gene: ENSMUSG00000030707

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140896
Predicted Effect probably benign
Transcript: ENSMUST00000142337
SMART Domains Protein: ENSMUSP00000117927
Gene: ENSMUSG00000059772

DomainStartEndE-ValueType
Pfam:GIY-YIG 10 58 1.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144571
Predicted Effect probably benign
Transcript: ENSMUST00000144897
SMART Domains Protein: ENSMUSP00000118182
Gene: ENSMUSG00000059772

DomainStartEndE-ValueType
GIYc 10 112 1.14e-3 SMART
low complexity region 152 163 N/A INTRINSIC
low complexity region 194 205 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
low complexity region 250 270 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155012
Predicted Effect probably benign
Transcript: ENSMUST00000173108
AA Change: F337L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000134123
Gene: ENSMUSG00000030707
AA Change: F337L

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
WD40 120 160 2.42e-7 SMART
WD40 163 204 6.09e-4 SMART
DUF1900 258 365 3.06e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173116
SMART Domains Protein: ENSMUSP00000133555
Gene: ENSMUSG00000030707

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174579
Predicted Effect probably benign
Transcript: ENSMUST00000205515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206275
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: This gene encodes a member of the WD repeat coronin family. The encoded protein may bind actin and interact with microtubules. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for null or hypomorph alleles of this gene display lower peripheral T cell counts resulting from defects in T cell migration and increased rates of apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,067,304 S751R probably damaging Het
4933417A18Rik T C 13: 34,932,653 probably benign Het
Abca8a A G 11: 110,026,343 V1610A probably damaging Het
Actl10 A T 2: 154,553,037 H202L probably benign Het
Alox12 A T 11: 70,245,935 V489E probably damaging Het
Ap4m1 T A 5: 138,172,203 F5I probably benign Het
Atn1 T C 6: 124,749,733 probably benign Het
Atrnl1 T A 19: 57,673,176 N529K probably benign Het
B3gntl1 C T 11: 121,619,715 G336D probably damaging Het
Bmp1 G A 14: 70,490,034 A703V probably damaging Het
Brat1 T G 5: 140,718,386 L798R probably damaging Het
Cacna1c C T 6: 118,625,497 G1302R probably damaging Het
Cdr2 A T 7: 120,958,731 D190E probably benign Het
Cenpe T C 3: 135,216,425 probably benign Het
Clstn1 A G 4: 149,644,178 D687G probably benign Het
Ddx49 T A 8: 70,296,925 I252F probably damaging Het
Dennd2a T A 6: 39,522,812 D273V possibly damaging Het
Derl2 A T 11: 71,014,561 F32I probably benign Het
Dmrta1 A G 4: 89,692,039 Y412C probably damaging Het
Dsg1a A G 18: 20,333,750 N559S probably damaging Het
Dusp26 G T 8: 31,091,959 R27L probably benign Het
Eif2ak3 T C 6: 70,885,218 I492T probably benign Het
Exoc7 G T 11: 116,300,398 Q219K probably damaging Het
F2r T C 13: 95,604,476 T184A probably damaging Het
Fbf1 G A 11: 116,152,462 probably benign Het
Fbxo28 A G 1: 182,317,015 M328T probably benign Het
Fsip2 T A 2: 82,991,075 D5717E possibly damaging Het
Gnpat C A 8: 124,880,225 S373R possibly damaging Het
Golgb1 G T 16: 36,875,579 probably benign Het
Greb1l T C 18: 10,523,374 V844A probably damaging Het
Hps1 G T 19: 42,770,899 probably null Het
Inppl1 G T 7: 101,828,195 probably benign Het
Isca1 C T 13: 59,758,885 probably null Het
Itgb2 T A 10: 77,542,475 C46S probably damaging Het
Kifc5b C T 17: 26,923,082 T178M probably benign Het
Krt80 T C 15: 101,352,299 T22A probably damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Ltbp2 C T 12: 84,806,424 probably benign Het
Mettl18 A G 1: 163,996,341 D77G probably benign Het
Mfsd2a A G 4: 122,950,168 L336P probably benign Het
Mgat4b A G 11: 50,230,919 probably null Het
Mtmr14 C T 6: 113,280,688 R233* probably null Het
Nbea T C 3: 56,029,907 Y761C probably damaging Het
Neb A T 2: 52,177,559 probably null Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Olfr814 T A 10: 129,873,942 I272L probably benign Het
Oxr1 T A 15: 41,817,197 M177K probably damaging Het
Pgm2l1 A G 7: 100,252,198 Y98C probably damaging Het
Pi4kb G T 3: 94,996,804 probably benign Het
Pi4kb G A 3: 94,996,805 probably benign Het
Pirb T A 7: 3,719,248 S199C probably benign Het
Prss23 A C 7: 89,509,847 I338S probably damaging Het
Rapgef3 A T 15: 97,757,819 probably benign Het
Rdh7 T A 10: 127,884,670 T278S probably benign Het
Rnf219 T C 14: 104,478,853 R695G possibly damaging Het
Rrp1b A G 17: 32,058,564 D606G probably benign Het
Rxfp1 T A 3: 79,652,377 Y379F possibly damaging Het
Rxfp2 T C 5: 150,067,388 V514A probably benign Het
Scel A T 14: 103,562,518 E202V probably benign Het
Slc25a36 G A 9: 97,080,204 A244V probably benign Het
Slc2a13 T G 15: 91,516,392 Q209P probably damaging Het
Slc38a6 A G 12: 73,352,530 N456S probably benign Het
Slc6a12 G T 6: 121,346,998 probably null Het
Spag6l T C 16: 16,780,629 I333V probably benign Het
Spen G A 4: 141,474,203 A2371V probably benign Het
St6galnac1 T C 11: 116,766,640 D366G probably damaging Het
Stk33 T C 7: 109,341,489 S5G probably benign Het
Tle2 T C 10: 81,577,648 L84P probably damaging Het
Tmem14a T C 1: 21,226,652 M78T probably damaging Het
Top2b T A 14: 16,413,556 probably null Het
Trmt13 A G 3: 116,582,650 F364S probably damaging Het
Unkl T A 17: 25,230,777 probably null Het
Uvrag A G 7: 99,004,719 probably benign Het
Vmn2r8 T A 5: 108,802,072 N303I probably benign Het
Vsig10l A G 7: 43,465,455 N360S probably damaging Het
Zdhhc25 T C 15: 88,600,920 Y153H probably damaging Het
Zfp646 T C 7: 127,883,262 V1537A possibly damaging Het
Zfp664 T A 5: 124,886,065 Y174* probably null Het
Other mutations in Coro1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Coro1a APN 7 126701529 missense probably benign 0.00
IGL02307:Coro1a APN 7 126701564 missense probably damaging 1.00
IGL02380:Coro1a APN 7 126703116 nonsense probably null
coralina UTSW 7 126703049 missense probably damaging 1.00
holiday UTSW 7 126700644 splice acceptor site probably null
R0009:Coro1a UTSW 7 126701413 splice site probably benign
R0009:Coro1a UTSW 7 126701413 splice site probably benign
R1275:Coro1a UTSW 7 126700583 critical splice donor site probably null
R1552:Coro1a UTSW 7 126699952 missense probably benign 0.13
R1598:Coro1a UTSW 7 126701692 missense possibly damaging 0.71
R1618:Coro1a UTSW 7 126701547 missense probably benign 0.05
R2116:Coro1a UTSW 7 126702022 missense probably damaging 1.00
R4591:Coro1a UTSW 7 126702992 missense probably damaging 1.00
R5159:Coro1a UTSW 7 126703049 missense probably damaging 1.00
R5261:Coro1a UTSW 7 126700644 splice site probably null
R6002:Coro1a UTSW 7 126703080 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCTCCCCATGAGACATTGAGCAC -3'
(R):5'- TGGTATGGGCTACATGCCCAAAC -3'

Sequencing Primer
(F):5'- TTGAGCACATCCATGCAGG -3'
(R):5'- CCAAACGTGGCCTGGAAG -3'
Posted On2013-04-24