Incidental Mutation 'R0394:Dusp26'
ID31868
Institutional Source Beutler Lab
Gene Symbol Dusp26
Ensembl Gene ENSMUSG00000039661
Gene Namedual specificity phosphatase 26 (putative)
Synonyms
MMRRC Submission 038600-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R0394 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location31089471-31097047 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 31091959 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 27 (R27L)
Ref Sequence ENSEMBL: ENSMUSP00000126397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036631] [ENSMUST00000161713] [ENSMUST00000170204]
Predicted Effect probably benign
Transcript: ENSMUST00000036631
AA Change: R27L

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000046794
Gene: ENSMUSG00000039661
AA Change: R27L

DomainStartEndE-ValueType
DSPc 61 204 3.1e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160700
Predicted Effect probably benign
Transcript: ENSMUST00000161713
AA Change: R27L

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124949
Gene: ENSMUSG00000039661
AA Change: R27L

DomainStartEndE-ValueType
DSPc 61 204 3.1e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162551
Predicted Effect probably benign
Transcript: ENSMUST00000170204
AA Change: R27L

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126397
Gene: ENSMUSG00000039661
AA Change: R27L

DomainStartEndE-ValueType
DSPc 61 204 3.1e-39 SMART
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tyrosine phosphatase family of proteins and exhibits dual specificity by dephosphorylating tyrosine as well as serine and threonine residues. This gene has been described as both a tumor suppressor and an oncogene depending on the cellular context. This protein may regulate neuronal proliferation and has been implicated in the progression of glioblastoma through its ability to dephosphorylate the p53 tumor suppressor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,067,304 S751R probably damaging Het
4933417A18Rik T C 13: 34,932,653 probably benign Het
Abca8a A G 11: 110,026,343 V1610A probably damaging Het
Actl10 A T 2: 154,553,037 H202L probably benign Het
Alox12 A T 11: 70,245,935 V489E probably damaging Het
Ap4m1 T A 5: 138,172,203 F5I probably benign Het
Atn1 T C 6: 124,749,733 probably benign Het
Atrnl1 T A 19: 57,673,176 N529K probably benign Het
B3gntl1 C T 11: 121,619,715 G336D probably damaging Het
Bmp1 G A 14: 70,490,034 A703V probably damaging Het
Brat1 T G 5: 140,718,386 L798R probably damaging Het
Cacna1c C T 6: 118,625,497 G1302R probably damaging Het
Cdr2 A T 7: 120,958,731 D190E probably benign Het
Cenpe T C 3: 135,216,425 probably benign Het
Clstn1 A G 4: 149,644,178 D687G probably benign Het
Coro1a A G 7: 126,700,640 F337L probably benign Het
Ddx49 T A 8: 70,296,925 I252F probably damaging Het
Dennd2a T A 6: 39,522,812 D273V possibly damaging Het
Derl2 A T 11: 71,014,561 F32I probably benign Het
Dmrta1 A G 4: 89,692,039 Y412C probably damaging Het
Dsg1a A G 18: 20,333,750 N559S probably damaging Het
Eif2ak3 T C 6: 70,885,218 I492T probably benign Het
Exoc7 G T 11: 116,300,398 Q219K probably damaging Het
F2r T C 13: 95,604,476 T184A probably damaging Het
Fbf1 G A 11: 116,152,462 probably benign Het
Fbxo28 A G 1: 182,317,015 M328T probably benign Het
Fsip2 T A 2: 82,991,075 D5717E possibly damaging Het
Gnpat C A 8: 124,880,225 S373R possibly damaging Het
Golgb1 G T 16: 36,875,579 probably benign Het
Greb1l T C 18: 10,523,374 V844A probably damaging Het
Hps1 G T 19: 42,770,899 probably null Het
Inppl1 G T 7: 101,828,195 probably benign Het
Isca1 C T 13: 59,758,885 probably null Het
Itgb2 T A 10: 77,542,475 C46S probably damaging Het
Kifc5b C T 17: 26,923,082 T178M probably benign Het
Krt80 T C 15: 101,352,299 T22A probably damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Ltbp2 C T 12: 84,806,424 probably benign Het
Mettl18 A G 1: 163,996,341 D77G probably benign Het
Mfsd2a A G 4: 122,950,168 L336P probably benign Het
Mgat4b A G 11: 50,230,919 probably null Het
Mtmr14 C T 6: 113,280,688 R233* probably null Het
Nbea T C 3: 56,029,907 Y761C probably damaging Het
Neb A T 2: 52,177,559 probably null Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Olfr814 T A 10: 129,873,942 I272L probably benign Het
Oxr1 T A 15: 41,817,197 M177K probably damaging Het
Pgm2l1 A G 7: 100,252,198 Y98C probably damaging Het
Pi4kb G T 3: 94,996,804 probably benign Het
Pi4kb G A 3: 94,996,805 probably benign Het
Pirb T A 7: 3,719,248 S199C probably benign Het
Prss23 A C 7: 89,509,847 I338S probably damaging Het
Rapgef3 A T 15: 97,757,819 probably benign Het
Rdh7 T A 10: 127,884,670 T278S probably benign Het
Rnf219 T C 14: 104,478,853 R695G possibly damaging Het
Rrp1b A G 17: 32,058,564 D606G probably benign Het
Rxfp1 T A 3: 79,652,377 Y379F possibly damaging Het
Rxfp2 T C 5: 150,067,388 V514A probably benign Het
Scel A T 14: 103,562,518 E202V probably benign Het
Slc25a36 G A 9: 97,080,204 A244V probably benign Het
Slc2a13 T G 15: 91,516,392 Q209P probably damaging Het
Slc38a6 A G 12: 73,352,530 N456S probably benign Het
Slc6a12 G T 6: 121,346,998 probably null Het
Spag6l T C 16: 16,780,629 I333V probably benign Het
Spen G A 4: 141,474,203 A2371V probably benign Het
St6galnac1 T C 11: 116,766,640 D366G probably damaging Het
Stk33 T C 7: 109,341,489 S5G probably benign Het
Tle2 T C 10: 81,577,648 L84P probably damaging Het
Tmem14a T C 1: 21,226,652 M78T probably damaging Het
Top2b T A 14: 16,413,556 probably null Het
Trmt13 A G 3: 116,582,650 F364S probably damaging Het
Unkl T A 17: 25,230,777 probably null Het
Uvrag A G 7: 99,004,719 probably benign Het
Vmn2r8 T A 5: 108,802,072 N303I probably benign Het
Vsig10l A G 7: 43,465,455 N360S probably damaging Het
Zdhhc25 T C 15: 88,600,920 Y153H probably damaging Het
Zfp646 T C 7: 127,883,262 V1537A possibly damaging Het
Zfp664 T A 5: 124,886,065 Y174* probably null Het
Other mutations in Dusp26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Dusp26 APN 8 31094108 missense probably benign 0.01
R0037:Dusp26 UTSW 8 31096360 missense unknown
R1792:Dusp26 UTSW 8 31091935 missense probably benign 0.01
R4454:Dusp26 UTSW 8 31094144 missense probably damaging 0.99
R4854:Dusp26 UTSW 8 31094137 missense probably damaging 1.00
R5638:Dusp26 UTSW 8 31094141 missense probably damaging 1.00
R6212:Dusp26 UTSW 8 31094224 missense probably damaging 1.00
R6337:Dusp26 UTSW 8 31096297 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTGCCTTCTCTCAGCTAAGAAC -3'
(R):5'- TCCTTGTACATACATGCACACACGC -3'

Sequencing Primer
(F):5'- AGGAATTAGTTGCTCTGGACTCAC -3'
(R):5'- CAGGCACGGTCTGTCCC -3'
Posted On2013-04-24