Incidental Mutation 'R0394:Gnpat'
ID31870
Institutional Source Beutler Lab
Gene Symbol Gnpat
Ensembl Gene ENSMUSG00000031985
Gene Nameglyceronephosphate O-acyltransferase
SynonymsD1Ertd819e
MMRRC Submission 038600-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock #R0394 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location124863033-124890057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 124880225 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 373 (S373R)
Ref Sequence ENSEMBL: ENSMUSP00000125323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034466] [ENSMUST00000161986]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034466
AA Change: S383R

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034466
Gene: ENSMUSG00000031985
AA Change: S383R

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
SCOP:d1dbha1 27 146 6e-3 SMART
PlsC 155 284 8.3e-21 SMART
Blast:PlsC 308 336 1e-6 BLAST
low complexity region 638 652 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161628
Predicted Effect possibly damaging
Transcript: ENSMUST00000161986
AA Change: S373R

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125323
Gene: ENSMUSG00000031985
AA Change: S373R

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
PlsC 145 274 8.3e-21 SMART
Blast:PlsC 298 326 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162455
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme located in the peroxisomal membrane which is essential to the synthesis of ether phospholipids. Mutations in this gene are associated with rhizomelic chondrodysplasia punctata. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice lack plasmalogens due to inactivation of ether lipid synthesis. Mutant mice exhibit dwarfism, male infertility, defects in eye development, and optic nerve hypoplasia. While some mice die prematurely, others, particularly females, are long-lived. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,067,304 S751R probably damaging Het
4933417A18Rik T C 13: 34,932,653 probably benign Het
Abca8a A G 11: 110,026,343 V1610A probably damaging Het
Actl10 A T 2: 154,553,037 H202L probably benign Het
Alox12 A T 11: 70,245,935 V489E probably damaging Het
Ap4m1 T A 5: 138,172,203 F5I probably benign Het
Atn1 T C 6: 124,749,733 probably benign Het
Atrnl1 T A 19: 57,673,176 N529K probably benign Het
B3gntl1 C T 11: 121,619,715 G336D probably damaging Het
Bmp1 G A 14: 70,490,034 A703V probably damaging Het
Brat1 T G 5: 140,718,386 L798R probably damaging Het
Cacna1c C T 6: 118,625,497 G1302R probably damaging Het
Cdr2 A T 7: 120,958,731 D190E probably benign Het
Cenpe T C 3: 135,216,425 probably benign Het
Clstn1 A G 4: 149,644,178 D687G probably benign Het
Coro1a A G 7: 126,700,640 F337L probably benign Het
Ddx49 T A 8: 70,296,925 I252F probably damaging Het
Dennd2a T A 6: 39,522,812 D273V possibly damaging Het
Derl2 A T 11: 71,014,561 F32I probably benign Het
Dmrta1 A G 4: 89,692,039 Y412C probably damaging Het
Dsg1a A G 18: 20,333,750 N559S probably damaging Het
Dusp26 G T 8: 31,091,959 R27L probably benign Het
Eif2ak3 T C 6: 70,885,218 I492T probably benign Het
Exoc7 G T 11: 116,300,398 Q219K probably damaging Het
F2r T C 13: 95,604,476 T184A probably damaging Het
Fbf1 G A 11: 116,152,462 probably benign Het
Fbxo28 A G 1: 182,317,015 M328T probably benign Het
Fsip2 T A 2: 82,991,075 D5717E possibly damaging Het
Golgb1 G T 16: 36,875,579 probably benign Het
Greb1l T C 18: 10,523,374 V844A probably damaging Het
Hps1 G T 19: 42,770,899 probably null Het
Inppl1 G T 7: 101,828,195 probably benign Het
Isca1 C T 13: 59,758,885 probably null Het
Itgb2 T A 10: 77,542,475 C46S probably damaging Het
Kifc5b C T 17: 26,923,082 T178M probably benign Het
Krt80 T C 15: 101,352,299 T22A probably damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Ltbp2 C T 12: 84,806,424 probably benign Het
Mettl18 A G 1: 163,996,341 D77G probably benign Het
Mfsd2a A G 4: 122,950,168 L336P probably benign Het
Mgat4b A G 11: 50,230,919 probably null Het
Mtmr14 C T 6: 113,280,688 R233* probably null Het
Nbea T C 3: 56,029,907 Y761C probably damaging Het
Neb A T 2: 52,177,559 probably null Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Olfr814 T A 10: 129,873,942 I272L probably benign Het
Oxr1 T A 15: 41,817,197 M177K probably damaging Het
Pgm2l1 A G 7: 100,252,198 Y98C probably damaging Het
Pi4kb G T 3: 94,996,804 probably benign Het
Pi4kb G A 3: 94,996,805 probably benign Het
Pirb T A 7: 3,719,248 S199C probably benign Het
Prss23 A C 7: 89,509,847 I338S probably damaging Het
Rapgef3 A T 15: 97,757,819 probably benign Het
Rdh7 T A 10: 127,884,670 T278S probably benign Het
Rnf219 T C 14: 104,478,853 R695G possibly damaging Het
Rrp1b A G 17: 32,058,564 D606G probably benign Het
Rxfp1 T A 3: 79,652,377 Y379F possibly damaging Het
Rxfp2 T C 5: 150,067,388 V514A probably benign Het
Scel A T 14: 103,562,518 E202V probably benign Het
Slc25a36 G A 9: 97,080,204 A244V probably benign Het
Slc2a13 T G 15: 91,516,392 Q209P probably damaging Het
Slc38a6 A G 12: 73,352,530 N456S probably benign Het
Slc6a12 G T 6: 121,346,998 probably null Het
Spag6l T C 16: 16,780,629 I333V probably benign Het
Spen G A 4: 141,474,203 A2371V probably benign Het
St6galnac1 T C 11: 116,766,640 D366G probably damaging Het
Stk33 T C 7: 109,341,489 S5G probably benign Het
Tle2 T C 10: 81,577,648 L84P probably damaging Het
Tmem14a T C 1: 21,226,652 M78T probably damaging Het
Top2b T A 14: 16,413,556 probably null Het
Trmt13 A G 3: 116,582,650 F364S probably damaging Het
Unkl T A 17: 25,230,777 probably null Het
Uvrag A G 7: 99,004,719 probably benign Het
Vmn2r8 T A 5: 108,802,072 N303I probably benign Het
Vsig10l A G 7: 43,465,455 N360S probably damaging Het
Zdhhc25 T C 15: 88,600,920 Y153H probably damaging Het
Zfp646 T C 7: 127,883,262 V1537A possibly damaging Het
Zfp664 T A 5: 124,886,065 Y174* probably null Het
Other mutations in Gnpat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Gnpat APN 8 124876914 splice site probably benign
IGL00422:Gnpat APN 8 124885013 missense probably damaging 1.00
IGL01327:Gnpat APN 8 124878633 missense probably damaging 1.00
IGL02257:Gnpat APN 8 124886848
IGL02951:Gnpat APN 8 124870905 missense probably benign 0.01
IGL03084:Gnpat APN 8 124878899 missense probably damaging 0.99
R0114:Gnpat UTSW 8 124883357 missense probably benign 0.06
R1023:Gnpat UTSW 8 124870780 missense probably benign 0.28
R1052:Gnpat UTSW 8 124877507 missense probably benign 0.00
R1052:Gnpat UTSW 8 124878516 missense probably damaging 1.00
R1537:Gnpat UTSW 8 124870816 missense probably damaging 0.97
R1604:Gnpat UTSW 8 124876961 missense probably damaging 1.00
R1711:Gnpat UTSW 8 124886952 splice site probably null
R1754:Gnpat UTSW 8 124877006 missense probably damaging 1.00
R2118:Gnpat UTSW 8 124876941 missense probably damaging 0.99
R2278:Gnpat UTSW 8 124876920 missense probably benign 0.35
R2429:Gnpat UTSW 8 124877019 missense probably damaging 1.00
R4579:Gnpat UTSW 8 124878502 splice site probably null
R6176:Gnpat UTSW 8 124878854 missense probably damaging 1.00
X0025:Gnpat UTSW 8 124873399 missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- GGCATTTTCGGTACAGACCCATCTC -3'
(R):5'- GTGCATCCCATATACGTACCAGGC -3'

Sequencing Primer
(F):5'- TGCACCAATTGACTGAAGCTG -3'
(R):5'- TATACGTACCAGGCCAAAGCAG -3'
Posted On2013-04-24