Incidental Mutation 'R4200:Etl4'
ID318708
Institutional Source Beutler Lab
Gene Symbol Etl4
Ensembl Gene ENSMUSG00000036617
Gene Nameenhancer trap locus 4
Synonyms6620402G01Rik, 9430077C05Rik, Skt, Sickle tail, E330027G05Rik, Etl-4
MMRRC Submission 041030-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.697) question?
Stock #R4200 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location19909780-20810713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 20781883 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 481 (H481Q)
Ref Sequence ENSEMBL: ENSMUSP00000110253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045555] [ENSMUST00000066509] [ENSMUST00000114604] [ENSMUST00000114606] [ENSMUST00000114607] [ENSMUST00000114608] [ENSMUST00000114614] [ENSMUST00000114627]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045555
AA Change: H763Q

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041431
Gene: ENSMUSG00000036617
AA Change: H763Q

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1067 1096 N/A INTRINSIC
low complexity region 1212 1231 N/A INTRINSIC
low complexity region 1296 1314 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000066509
AA Change: H798Q

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000066170
Gene: ENSMUSG00000036617
AA Change: H798Q

DomainStartEndE-ValueType
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1372 1381 N/A INTRINSIC
low complexity region 1470 1495 N/A INTRINSIC
low complexity region 1571 1582 N/A INTRINSIC
coiled coil region 1658 1686 N/A INTRINSIC
low complexity region 1724 1737 N/A INTRINSIC
low complexity region 1806 1825 N/A INTRINSIC
low complexity region 1890 1908 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114604
AA Change: H798Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110251
Gene: ENSMUSG00000036617
AA Change: H798Q

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1207 1226 N/A INTRINSIC
low complexity region 1291 1309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114606
AA Change: H481Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110253
Gene: ENSMUSG00000036617
AA Change: H481Q

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
coiled coil region 338 370 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114607
AA Change: H481Q

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110254
Gene: ENSMUSG00000036617
AA Change: H481Q

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
coiled coil region 338 370 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114608
AA Change: H481Q

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110255
Gene: ENSMUSG00000036617
AA Change: H481Q

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
coiled coil region 338 370 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
low complexity region 1055 1064 N/A INTRINSIC
low complexity region 1153 1178 N/A INTRINSIC
low complexity region 1254 1265 N/A INTRINSIC
coiled coil region 1341 1369 N/A INTRINSIC
low complexity region 1407 1420 N/A INTRINSIC
low complexity region 1489 1508 N/A INTRINSIC
low complexity region 1573 1591 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114614
AA Change: H763Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110261
Gene: ENSMUSG00000036617
AA Change: H763Q

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1056 1085 N/A INTRINSIC
low complexity region 1201 1220 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114627
AA Change: H849Q

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110274
Gene: ENSMUSG00000036617
AA Change: H849Q

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
Pfam:AIP3 239 341 2.4e-14 PFAM
low complexity region 364 379 N/A INTRINSIC
low complexity region 401 419 N/A INTRINSIC
Pfam:AIP3 600 841 1.1e-12 PFAM
low complexity region 1153 1182 N/A INTRINSIC
low complexity region 1423 1432 N/A INTRINSIC
low complexity region 1521 1546 N/A INTRINSIC
low complexity region 1622 1633 N/A INTRINSIC
coiled coil region 1709 1737 N/A INTRINSIC
low complexity region 1775 1788 N/A INTRINSIC
low complexity region 1857 1876 N/A INTRINSIC
low complexity region 1941 1959 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146488
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele display malformations of the notochord and caudal vertebrae and may exhibit caudal tail kinks. Mice homozygous for another gene-trapped allele have malformed caudal vertebrae and intervertebral disk abnormalities; about half display kinked tails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 60,039,534 Y218N probably damaging Het
Aox3 A G 1: 58,188,378 E1214G probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Asxl1 C A 2: 153,400,106 L859I possibly damaging Het
C7 A G 15: 4,990,309 probably null Het
Col6a3 C A 1: 90,801,383 V1279L probably benign Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Gm3336 A T 8: 70,720,612 D91V probably benign Het
Hnf4g T G 3: 3,651,284 V256G possibly damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Ifi203 A C 1: 173,924,115 I380S probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Mboat7 C A 7: 3,685,753 A259S possibly damaging Het
Mroh8 C T 2: 157,241,810 V381M probably benign Het
Muc5b T A 7: 141,858,925 C1869* probably null Het
Nfatc4 C T 14: 55,832,032 R672W probably damaging Het
Nup210l T C 3: 90,119,911 I200T probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olr1 A G 6: 129,502,105 V50A probably damaging Het
Pcdhgb5 A G 18: 37,731,982 I277V possibly damaging Het
Pknox1 C A 17: 31,599,610 N272K probably benign Het
Psg23 T C 7: 18,612,065 D235G probably damaging Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Tgm2 C A 2: 158,132,490 R207L probably benign Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttc24 T C 3: 88,074,517 T81A probably benign Het
Ttll1 A T 15: 83,492,577 I315N probably damaging Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Vmn1r18 A T 6: 57,390,116 V151E probably benign Het
Vmn2r100 T A 17: 19,522,535 D390E probably benign Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp58 T G 13: 67,491,321 R350S probably benign Het
Other mutations in Etl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Etl4 APN 2 20766478 missense possibly damaging 0.81
IGL00944:Etl4 APN 2 20530054 missense possibly damaging 0.52
IGL01078:Etl4 APN 2 20806531 nonsense probably null
IGL01099:Etl4 APN 2 20807111 missense probably benign 0.06
IGL01337:Etl4 APN 2 20785387 missense probably benign 0.01
IGL01348:Etl4 APN 2 20806973 missense probably damaging 1.00
IGL01349:Etl4 APN 2 20713396 missense probably damaging 1.00
IGL01407:Etl4 APN 2 20743856 missense probably damaging 0.99
IGL01552:Etl4 APN 2 20778189 missense probably damaging 0.99
IGL01662:Etl4 APN 2 20806649 missense probably benign 0.04
IGL01687:Etl4 APN 2 20530087 missense probably damaging 1.00
IGL01793:Etl4 APN 2 20743898 missense possibly damaging 0.87
IGL01844:Etl4 APN 2 20806682 missense probably benign 0.06
IGL02025:Etl4 APN 2 20806526 missense probably damaging 1.00
IGL02088:Etl4 APN 2 20806548 missense probably damaging 1.00
IGL02134:Etl4 APN 2 20806429 missense possibly damaging 0.79
IGL02369:Etl4 APN 2 20530189 missense probably damaging 1.00
IGL02480:Etl4 APN 2 20788524 missense probably damaging 0.99
IGL02560:Etl4 APN 2 20743718 missense probably damaging 1.00
IGL02851:Etl4 APN 2 20808029 missense possibly damaging 0.46
IGL02893:Etl4 APN 2 20760210 splice site probably benign
IGL02951:Etl4 APN 2 20801537 splice site probably benign
IGL03119:Etl4 APN 2 20713387 missense probably damaging 1.00
IGL03267:Etl4 APN 2 20785182 nonsense probably null
IGL03379:Etl4 APN 2 20662016 missense possibly damaging 0.87
R0038:Etl4 UTSW 2 20743574 missense probably damaging 1.00
R0038:Etl4 UTSW 2 20743574 missense probably damaging 1.00
R0095:Etl4 UTSW 2 20743868 missense probably damaging 1.00
R0100:Etl4 UTSW 2 20339905 missense probably benign
R0311:Etl4 UTSW 2 20807129 missense probably damaging 1.00
R0346:Etl4 UTSW 2 20759652 critical splice donor site probably null
R0348:Etl4 UTSW 2 20778129 missense probably damaging 1.00
R0379:Etl4 UTSW 2 20807354 missense probably damaging 0.98
R0571:Etl4 UTSW 2 20743769 missense probably damaging 0.99
R0697:Etl4 UTSW 2 20743861 missense probably damaging 1.00
R0707:Etl4 UTSW 2 20805571 splice site probably benign
R0980:Etl4 UTSW 2 20801567 missense probably damaging 1.00
R1120:Etl4 UTSW 2 20806703 missense probably benign 0.00
R1254:Etl4 UTSW 2 20807923 missense probably damaging 1.00
R1346:Etl4 UTSW 2 20806144 missense possibly damaging 0.94
R1460:Etl4 UTSW 2 20788477 missense probably damaging 1.00
R1503:Etl4 UTSW 2 20743874 missense possibly damaging 0.94
R1547:Etl4 UTSW 2 20785228 missense probably damaging 1.00
R1627:Etl4 UTSW 2 20801579 missense possibly damaging 0.91
R1635:Etl4 UTSW 2 20806408 missense probably damaging 1.00
R1716:Etl4 UTSW 2 20743681 missense probably damaging 1.00
R1795:Etl4 UTSW 2 20808026 critical splice donor site probably null
R1885:Etl4 UTSW 2 20743984 missense probably damaging 1.00
R2039:Etl4 UTSW 2 20785228 missense probably damaging 1.00
R2083:Etl4 UTSW 2 20743549 missense probably damaging 1.00
R2109:Etl4 UTSW 2 20785342 missense probably benign 0.27
R2153:Etl4 UTSW 2 20798734 missense probably benign 0.00
R2403:Etl4 UTSW 2 20807306 nonsense probably null
R2883:Etl4 UTSW 2 20806174 missense possibly damaging 0.83
R2985:Etl4 UTSW 2 20781849 missense probably damaging 1.00
R3402:Etl4 UTSW 2 20781882 missense probably damaging 1.00
R3696:Etl4 UTSW 2 20801662 critical splice donor site probably null
R3755:Etl4 UTSW 2 20743537 missense probably benign 0.10
R3813:Etl4 UTSW 2 20788435 missense probably damaging 1.00
R3829:Etl4 UTSW 2 20785421 missense probably benign 0.07
R3887:Etl4 UTSW 2 20529961 nonsense probably null
R3888:Etl4 UTSW 2 20529961 nonsense probably null
R3889:Etl4 UTSW 2 20529961 nonsense probably null
R3958:Etl4 UTSW 2 20340043 missense probably benign
R3959:Etl4 UTSW 2 20340043 missense probably benign
R3960:Etl4 UTSW 2 20340043 missense probably benign
R4058:Etl4 UTSW 2 20806019 missense possibly damaging 0.59
R4074:Etl4 UTSW 2 20809219 utr 3 prime probably benign
R4077:Etl4 UTSW 2 20807961 missense probably damaging 1.00
R4078:Etl4 UTSW 2 20807961 missense probably damaging 1.00
R4127:Etl4 UTSW 2 20744075 missense possibly damaging 0.93
R4492:Etl4 UTSW 2 20806865 missense possibly damaging 0.67
R4514:Etl4 UTSW 2 20661898 missense probably damaging 1.00
R4820:Etl4 UTSW 2 20806685 missense possibly damaging 0.85
R4825:Etl4 UTSW 2 20806927 missense probably damaging 1.00
R4888:Etl4 UTSW 2 20340111 critical splice donor site probably null
R4938:Etl4 UTSW 2 20798649 missense probably benign 0.00
R4943:Etl4 UTSW 2 20807281 missense probably benign 0.05
R5121:Etl4 UTSW 2 20340111 critical splice donor site probably null
R5191:Etl4 UTSW 2 20339999 missense probably damaging 0.99
R5198:Etl4 UTSW 2 20713387 missense probably damaging 1.00
R5199:Etl4 UTSW 2 20744042 missense probably damaging 1.00
R5470:Etl4 UTSW 2 20529980 missense probably damaging 0.99
R5513:Etl4 UTSW 2 20743827 missense probably damaging 1.00
R5620:Etl4 UTSW 2 20530226 missense probably damaging 1.00
R5635:Etl4 UTSW 2 20807035 missense probably damaging 1.00
R5641:Etl4 UTSW 2 20806462 frame shift probably null
R5690:Etl4 UTSW 2 20805836 missense probably benign 0.01
R5784:Etl4 UTSW 2 20806205 missense possibly damaging 0.79
R5794:Etl4 UTSW 2 20806512 missense probably damaging 1.00
R5908:Etl4 UTSW 2 20743907 missense probably damaging 0.96
R5982:Etl4 UTSW 2 20781015 missense probably damaging 1.00
R6151:Etl4 UTSW 2 20713360 missense probably damaging 1.00
R6192:Etl4 UTSW 2 20801551 missense probably damaging 0.98
R6238:Etl4 UTSW 2 20801568 missense probably damaging 1.00
R6248:Etl4 UTSW 2 20809089 missense possibly damaging 0.90
R6292:Etl4 UTSW 2 20743573 missense probably damaging 1.00
R6610:Etl4 UTSW 2 20713369 missense probably damaging 1.00
R6739:Etl4 UTSW 2 20713435 missense probably damaging 1.00
R6846:Etl4 UTSW 2 20744108 missense possibly damaging 0.94
R6863:Etl4 UTSW 2 20806309 missense probably benign 0.01
R6873:Etl4 UTSW 2 20797992 synonymous probably null
R7003:Etl4 UTSW 2 20805884 missense probably benign 0.03
R7155:Etl4 UTSW 2 20806931 missense probably damaging 0.96
R7207:Etl4 UTSW 2 20709576 missense probably damaging 0.99
R7230:Etl4 UTSW 2 20797988 missense probably damaging 1.00
R7305:Etl4 UTSW 2 20709557 missense probably damaging 1.00
X0018:Etl4 UTSW 2 20809190 missense probably damaging 0.98
X0022:Etl4 UTSW 2 20709564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCTACCCTAGGTCACAG -3'
(R):5'- TTGCAACGAACATTTGGGG -3'

Sequencing Primer
(F):5'- TACCCTAGGTCACAGGAGTGG -3'
(R):5'- CTGAAACAGTTGAGGGTTCTCC -3'
Posted On2015-06-10