Incidental Mutation 'R4201:Arfgef3'
ID318757
Institutional Source Beutler Lab
Gene Symbol Arfgef3
Ensembl Gene ENSMUSG00000019852
Gene NameARFGEF family member 3
SynonymsB930094H20Rik, D10Bwg1379e, BIG3
MMRRC Submission 041031-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R4201 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location18581839-18743949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18619782 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1167 (S1167P)
Ref Sequence ENSEMBL: ENSMUSP00000149210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019999] [ENSMUST00000215836]
Predicted Effect probably benign
Transcript: ENSMUST00000019999
AA Change: S1167P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000019999
Gene: ENSMUSG00000019852
AA Change: S1167P

DomainStartEndE-ValueType
Pfam:DCB 1 170 7.1e-15 PFAM
low complexity region 236 245 N/A INTRINSIC
low complexity region 276 295 N/A INTRINSIC
low complexity region 452 462 N/A INTRINSIC
Sec7 582 794 6e-54 SMART
Blast:Sec7 798 873 3e-20 BLAST
low complexity region 927 940 N/A INTRINSIC
Pfam:DUF1981 1237 1312 1.9e-14 PFAM
low complexity region 1641 1652 N/A INTRINSIC
low complexity region 1710 1723 N/A INTRINSIC
low complexity region 1838 1856 N/A INTRINSIC
low complexity region 2088 2099 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215836
AA Change: S1167P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased insulin granule biogenesis and insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A G 18: 6,623,952 probably null Het
Als2 A T 1: 59,180,154 D1212E possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp1b2 A G 11: 69,603,469 V66A possibly damaging Het
Bag3 C A 7: 128,546,157 L499I probably damaging Het
Boc T C 16: 44,490,618 D751G probably damaging Het
Camk1d T C 2: 5,354,776 Y145C probably benign Het
Ccdc172 G A 19: 58,536,585 R158H probably benign Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cd9 T C 6: 125,462,394 D125G possibly damaging Het
Cep295 T C 9: 15,332,538 I1493V probably benign Het
Chrna5 A G 9: 54,998,075 D57G probably benign Het
Cul7 C T 17: 46,661,312 R1201W probably damaging Het
Dnah1 A G 14: 31,262,270 V3976A probably benign Het
Dnah11 T C 12: 117,966,659 D3317G possibly damaging Het
Dnmt3b G T 2: 153,670,417 E353* probably null Het
Gch1 T C 14: 47,155,803 S241G probably benign Het
Gpr22 A T 12: 31,708,913 Y366* probably null Het
Gse1 A T 8: 120,567,764 M277L probably benign Het
Kcnt2 G A 1: 140,425,332 V260I probably damaging Het
Nbas G T 12: 13,374,826 C1022F probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr776 T C 10: 129,261,777 V272A probably benign Het
Olfr807 A T 10: 129,754,628 L274H probably damaging Het
Parp4 C A 14: 56,592,391 T274K possibly damaging Het
Pgs1 A G 11: 118,002,536 S230G probably damaging Het
Plin4 T G 17: 56,104,338 T898P probably damaging Het
Ptprj A C 2: 90,463,095 V548G probably damaging Het
Sec23a T C 12: 59,002,005 I139M probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Stx17 T A 4: 48,158,870 D83E probably damaging Het
Syne1 A T 10: 5,347,870 D1142E probably benign Het
Tbccd1 A G 16: 22,825,948 V226A probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmed7 A G 18: 46,593,247 probably null Het
Tnfrsf23 A T 7: 143,670,054 C137S probably damaging Het
Vmn2r87 T C 10: 130,472,579 I597V probably benign Het
Other mutations in Arfgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Arfgef3 APN 10 18660604 missense probably benign 0.03
IGL00835:Arfgef3 APN 10 18661358 missense probably benign
IGL00961:Arfgef3 APN 10 18611237 missense probably damaging 1.00
IGL01400:Arfgef3 APN 10 18652706 missense probably damaging 1.00
IGL01501:Arfgef3 APN 10 18600560 missense possibly damaging 0.93
IGL01595:Arfgef3 APN 10 18594912 missense possibly damaging 0.93
IGL01695:Arfgef3 APN 10 18603419 missense probably benign 0.00
IGL01774:Arfgef3 APN 10 18743615 missense possibly damaging 0.94
IGL02348:Arfgef3 APN 10 18591347 missense probably benign 0.04
IGL02371:Arfgef3 APN 10 18646539 missense probably benign
IGL02400:Arfgef3 APN 10 18646257 missense probably damaging 1.00
IGL02630:Arfgef3 APN 10 18661392 splice site probably benign
IGL02815:Arfgef3 APN 10 18652551 missense probably damaging 1.00
IGL03178:Arfgef3 APN 10 18613225 missense probably damaging 1.00
IGL03182:Arfgef3 APN 10 18600544 missense probably damaging 1.00
IGL03267:Arfgef3 APN 10 18591882 missense probably damaging 1.00
IGL03294:Arfgef3 APN 10 18664912 missense probably damaging 0.97
IGL03410:Arfgef3 APN 10 18600490 missense probably damaging 1.00
Bow-wow UTSW 10 18646730 nonsense probably null
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0141:Arfgef3 UTSW 10 18597407 missense probably damaging 1.00
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0241:Arfgef3 UTSW 10 18599214 missense probably damaging 1.00
R0334:Arfgef3 UTSW 10 18592281 missense probably damaging 0.98
R0352:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R0415:Arfgef3 UTSW 10 18613127 splice site probably benign
R0417:Arfgef3 UTSW 10 18603511 missense probably damaging 1.00
R0442:Arfgef3 UTSW 10 18677815 splice site probably benign
R0507:Arfgef3 UTSW 10 18591621 missense probably damaging 1.00
R0573:Arfgef3 UTSW 10 18599288 missense probably damaging 1.00
R0582:Arfgef3 UTSW 10 18611290 missense probably damaging 1.00
R0609:Arfgef3 UTSW 10 18597431 missense probably benign 0.31
R0826:Arfgef3 UTSW 10 18589666 missense probably damaging 0.98
R0919:Arfgef3 UTSW 10 18589735 missense possibly damaging 0.89
R0980:Arfgef3 UTSW 10 18592118 missense possibly damaging 0.82
R1027:Arfgef3 UTSW 10 18591375 missense probably benign 0.02
R1140:Arfgef3 UTSW 10 18597348 missense possibly damaging 0.77
R1491:Arfgef3 UTSW 10 18646554 missense probably damaging 1.00
R1493:Arfgef3 UTSW 10 18630879 missense probably damaging 0.96
R1529:Arfgef3 UTSW 10 18613222 nonsense probably null
R1564:Arfgef3 UTSW 10 18591704 missense probably damaging 1.00
R1654:Arfgef3 UTSW 10 18625148 missense probably null 0.15
R1868:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R1876:Arfgef3 UTSW 10 18597356 missense probably damaging 1.00
R1908:Arfgef3 UTSW 10 18652763 missense possibly damaging 0.80
R2211:Arfgef3 UTSW 10 18592245 missense possibly damaging 0.54
R2316:Arfgef3 UTSW 10 18616953 missense probably benign 0.19
R2393:Arfgef3 UTSW 10 18597787 missense possibly damaging 0.88
R2407:Arfgef3 UTSW 10 18677866 missense possibly damaging 0.63
R3076:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3077:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3963:Arfgef3 UTSW 10 18592277 missense probably damaging 1.00
R4241:Arfgef3 UTSW 10 18625164 missense probably damaging 1.00
R4244:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R4395:Arfgef3 UTSW 10 18597709 missense probably damaging 1.00
R4455:Arfgef3 UTSW 10 18607675 missense probably benign 0.18
R4480:Arfgef3 UTSW 10 18600600 missense probably damaging 1.00
R4499:Arfgef3 UTSW 10 18608343 missense possibly damaging 0.95
R4589:Arfgef3 UTSW 10 18646199 missense probably damaging 1.00
R4635:Arfgef3 UTSW 10 18634855 missense probably damaging 1.00
R4776:Arfgef3 UTSW 10 18654247 missense probably benign
R4801:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4802:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4807:Arfgef3 UTSW 10 18646637 missense probably benign
R4828:Arfgef3 UTSW 10 18652693 missense probably damaging 0.99
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4917:Arfgef3 UTSW 10 18616890 missense probably damaging 0.99
R4918:Arfgef3 UTSW 10 18616890 missense probably damaging 0.99
R4922:Arfgef3 UTSW 10 18592186 missense probably damaging 0.97
R4929:Arfgef3 UTSW 10 18630851 missense probably benign 0.00
R4937:Arfgef3 UTSW 10 18589706 missense probably damaging 0.98
R5290:Arfgef3 UTSW 10 18600460 missense probably damaging 1.00
R5410:Arfgef3 UTSW 10 18611237 missense probably damaging 0.99
R5807:Arfgef3 UTSW 10 18647798 splice site probably null
R5832:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R5887:Arfgef3 UTSW 10 18607665 nonsense probably null
R6272:Arfgef3 UTSW 10 18646963 missense probably benign 0.00
R6302:Arfgef3 UTSW 10 18652841 missense probably damaging 0.97
R6397:Arfgef3 UTSW 10 18607665 nonsense probably null
R6495:Arfgef3 UTSW 10 18611202 critical splice donor site probably null
R6707:Arfgef3 UTSW 10 18621155 missense probably benign 0.11
R6814:Arfgef3 UTSW 10 18595019 missense probably damaging 1.00
R6830:Arfgef3 UTSW 10 18664889 critical splice donor site probably null
R6870:Arfgef3 UTSW 10 18646730 nonsense probably null
R6941:Arfgef3 UTSW 10 18625455 missense possibly damaging 0.66
R7094:Arfgef3 UTSW 10 18646439 missense probably damaging 1.00
R7179:Arfgef3 UTSW 10 18599267 missense probably damaging 1.00
R7204:Arfgef3 UTSW 10 18646462 missense probably damaging 1.00
R7247:Arfgef3 UTSW 10 18625391 missense probably benign 0.00
R7249:Arfgef3 UTSW 10 18630835 missense possibly damaging 0.62
R7318:Arfgef3 UTSW 10 18630463 missense possibly damaging 0.89
R7391:Arfgef3 UTSW 10 18646259 missense probably benign 0.05
R7527:Arfgef3 UTSW 10 18646629 missense probably benign
X0026:Arfgef3 UTSW 10 18652626 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTCACATTTACGGGCTC -3'
(R):5'- TCTCTGCAAACACAGTATTGAGTC -3'

Sequencing Primer
(F):5'- ACATTTACGGGCTCTTCTCAAC -3'
(R):5'- GCTGAATGAACCACCTTGCTAGTG -3'
Posted On2015-06-10