Incidental Mutation 'R4202:Tas2r138'
ID318790
Institutional Source Beutler Lab
Gene Symbol Tas2r138
Ensembl Gene ENSMUSG00000058250
Gene Nametaste receptor, type 2, member 138
Synonymsmt2r31, T2R138, Tas2r38
MMRRC Submission 041032-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4202 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location40612315-40613310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40612476 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 279 (M279V)
Ref Sequence ENSEMBL: ENSMUSP00000075876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076565]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076565
AA Change: M279V

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075876
Gene: ENSMUSG00000058250
AA Change: M279V

DomainStartEndE-ValueType
Pfam:TAS2R 11 315 3.8e-64 PFAM
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 92% (33/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-transmembrane G protein-coupled receptor that controls the ability to taste glucosinolates, a family of bitter-tasting compounds found in plants of the Brassica sp. Synthetic compounds phenylthiocarbamide (PTC) and 6-n-propylthiouracil (PROP) have been identified as ligands for this receptor and have been used to test the genetic diversity of this gene. Although several allelic forms of this gene have been identified worldwide, there are two predominant common forms (taster and non-taster) found outside of Africa. These alleles differ at three nucleotide positions resulting in amino acid changes in the protein (A49P, A262V, and V296I) with the amino acid combination PAV identifying the taster variant (and AVI identifying the non-taster variant). [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adsl C T 15: 80,952,216 T58I probably damaging Het
Ano7 A G 1: 93,380,478 D77G probably benign Het
Ap2b1 T A 11: 83,335,604 probably null Het
Bclaf3 T A X: 159,553,833 S419T probably damaging Het
Bysl A G 17: 47,604,326 S166P probably benign Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cdc42bpb G A 12: 111,294,139 P1702S probably benign Het
Cfap65 G T 1: 74,920,542 F816L probably damaging Het
Cnot6 T C 11: 49,702,636 Y6C probably damaging Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Gmeb2 A G 2: 181,253,973 V468A possibly damaging Het
Gucy2g A G 19: 55,229,769 S416P possibly damaging Het
Hormad1 G A 3: 95,585,198 R362H probably benign Het
Lancl2 T A 6: 57,712,992 V61D probably benign Het
Lta4h A G 10: 93,470,807 D287G probably damaging Het
Maml1 A T 11: 50,257,913 L1000Q probably damaging Het
Olfr776 T C 10: 129,261,777 V272A probably benign Het
Olfr8 T C 10: 78,955,295 V30A probably benign Het
Osbpl9 G T 4: 109,172,240 probably benign Het
Oser1 T C 2: 163,411,455 T45A probably benign Het
Ppfibp1 C A 6: 147,029,581 S878R probably damaging Het
Prss43 T A 9: 110,827,461 V72D probably benign Het
Sdhb T A 4: 140,979,068 M272K possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Stx17 T A 4: 48,158,870 D83E probably damaging Het
Tmem55b A G 14: 50,930,655 S41P probably damaging Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Vmn2r87 T C 10: 130,472,579 I597V probably benign Het
Wnt5b T C 6: 119,440,311 N198D probably damaging Het
Other mutations in Tas2r138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00550:Tas2r138 APN 6 40612586 missense probably benign 0.07
IGL01468:Tas2r138 APN 6 40612476 missense probably benign 0.22
IGL02626:Tas2r138 APN 6 40612715 missense possibly damaging 0.61
IGL03008:Tas2r138 APN 6 40613182 missense probably damaging 1.00
R0595:Tas2r138 UTSW 6 40612865 missense probably damaging 1.00
R2845:Tas2r138 UTSW 6 40612767 missense probably benign 0.09
R2975:Tas2r138 UTSW 6 40613264 missense probably benign 0.00
R4923:Tas2r138 UTSW 6 40612886 missense possibly damaging 0.82
R5526:Tas2r138 UTSW 6 40612980 missense probably benign 0.00
R6647:Tas2r138 UTSW 6 40612799 missense possibly damaging 0.91
R6869:Tas2r138 UTSW 6 40612421 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTTATCAGAGTGTCCTGGG -3'
(R):5'- CTTCTGCAATGTGGGCTCTGTC -3'

Sequencing Primer
(F):5'- CTGGGAGGAACCTTGTGGAC -3'
(R):5'- TCCCTGGGGAGTCACATGAG -3'
Posted On2015-06-10