Mutagenetix > Incidental Mutation

Incidental Mutation 'R4202:Bysl'

318807

Institutional Source

Beutler Lab

Gene Symbol

Bysl

Ensembl Gene

ENSMUSG00000023988

Gene Name

bystin-like

Synonyms

Enp1

MMRRC Submission

041032-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4202 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

47910256-47922417 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 47915251 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 166 (S166P)

Ref Sequence

ENSEMBL: ENSMUSP00000024783 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024783] [ENSMUST00000037333] [ENSMUST00000171031] [ENSMUST00000182209] [ENSMUST00000183044] [ENSMUST00000183177]

AlphaFold

O54825

Predicted Effect

probably benign
Transcript: ENSMUST00000024783
AA Change: S166P

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000024783
Gene: ENSMUSG00000023988
AA Change: S166P

Domain	Start	End	E-Value	Type
low complexity region	34	47	N/A	INTRINSIC
low complexity region	52	69	N/A	INTRINSIC
Pfam:Bystin	140	430	1.1e-144	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000037333

SMART Domains

Protein: ENSMUSP00000040488
Gene: ENSMUSG00000034165

Domain	Start	End	E-Value	Type
CYCLIN	62	146	1.12e-17	SMART
Cyclin_C	155	280	3.49e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171031

SMART Domains

Protein: ENSMUSP00000126141
Gene: ENSMUSG00000034165

Domain	Start	End	E-Value	Type
CYCLIN	62	146	1.12e-17	SMART
Cyclin_C	155	280	3.49e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182209

SMART Domains

Protein: ENSMUSP00000138091
Gene: ENSMUSG00000034165

Domain	Start	End	E-Value	Type
CYCLIN	62	146	1.12e-17	SMART
Cyclin_C	155	280	3.49e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000183044

SMART Domains

Protein: ENSMUSP00000138220
Gene: ENSMUSG00000034165

Domain	Start	End	E-Value	Type
CYCLIN	62	146	1.12e-17	SMART
Cyclin_C	155	280	3.49e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000183177

SMART Domains

Protein: ENSMUSP00000138640
Gene: ENSMUSG00000034165

Domain	Start	End	E-Value	Type
CYCLIN	62	146	1.12e-17	SMART
Cyclin_C	155	280	3.49e-16	SMART

Meta Mutation Damage Score

0.2225

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

92% (33/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bystin is expressed as a 2-kb major transcript and a 3.6-kb minor transcript in SNG-M cells and in human trophoblastic teratocarcinoma HT-H cells. Protein binding assays determined that bystin binds directly to trophinin and tastin, and that binding is enhanced when cytokeratins 8 and 18 are present. Immunocytochemistry of HT-H cells showed that bystin colocalizes with trophinin, tastin, and the cytokeratins, suggesting that these molecules form a complex in trophectoderm cells at the time of implantation. Using immunohistochemistry it was determined that trophinin and bystin are found in the placenta from the sixth week of pregnancy. Both proteins were localized in the cytoplasm of the syncytiotrophoblast in the chorionic villi and in endometrial decidual cells at the uteroplacental interface. After week 10, the levels of trophinin, tastin, and bystin decreased and then disappeared from placental villi. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality shortly after implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adsl	C	T	15: 80,836,417 (GRCm39)	T58I	probably damaging	Het
Ano7	A	G	1: 93,308,200 (GRCm39)	D77G	probably benign	Het
Ap2b1	T	A	11: 83,226,430 (GRCm39)		probably null	Het
Bclaf3	T	A	X: 158,336,829 (GRCm39)	S419T	probably damaging	Het
Cd101	A	C	3: 100,926,001 (GRCm39)	D239E	probably damaging	Het
Cdc42bpb	G	A	12: 111,260,573 (GRCm39)	P1702S	probably benign	Het
Cfap65	G	T	1: 74,959,701 (GRCm39)	F816L	probably damaging	Het
Cnot6	T	C	11: 49,593,463 (GRCm39)	Y6C	probably damaging	Het
Csrp1	T	G	1: 135,673,065 (GRCm39)	C61G	probably damaging	Het
Gmeb2	A	G	2: 180,895,766 (GRCm39)	V468A	possibly damaging	Het
Gucy2g	A	G	19: 55,218,201 (GRCm39)	S416P	possibly damaging	Het
Hormad1	G	A	3: 95,492,509 (GRCm39)	R362H	probably benign	Het
Lancl2	T	A	6: 57,689,977 (GRCm39)	V61D	probably benign	Het
Lta4h	A	G	10: 93,306,669 (GRCm39)	D287G	probably damaging	Het
Maml1	A	T	11: 50,148,740 (GRCm39)	L1000Q	probably damaging	Het
Or6c206	T	C	10: 129,097,646 (GRCm39)	V272A	probably benign	Het
Or7a42	T	C	10: 78,791,129 (GRCm39)	V30A	probably benign	Het
Osbpl9	G	T	4: 109,029,437 (GRCm39)		probably benign	Het
Oser1	T	C	2: 163,253,375 (GRCm39)	T45A	probably benign	Het
Pip4p1	A	G	14: 51,168,112 (GRCm39)	S41P	probably damaging	Het
Ppfibp1	C	A	6: 146,931,079 (GRCm39)	S878R	probably damaging	Het
Prss43	T	A	9: 110,656,529 (GRCm39)	V72D	probably benign	Het
Sdhb	T	A	4: 140,706,379 (GRCm39)	M272K	possibly damaging	Het
Shroom3	G	T	5: 93,090,945 (GRCm39)	V1151F	probably damaging	Het
Stx17	T	A	4: 48,158,870 (GRCm39)	D83E	probably damaging	Het
Tas2r138	T	C	6: 40,589,410 (GRCm39)	M279V	possibly damaging	Het
Tsku	C	T	7: 98,002,205 (GRCm39)	R42H	probably damaging	Het
Tyr	A	G	7: 87,078,276 (GRCm39)	L528P	possibly damaging	Het
Vmn2r87	T	C	10: 130,308,448 (GRCm39)	I597V	probably benign	Het
Wnt5b	T	C	6: 119,417,272 (GRCm39)	N198D	probably damaging	Het

Other mutations in Bysl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Bysl	APN	17	47,912,796 (GRCm39)	missense	probably benign	0.25
IGL01343:Bysl	APN	17	47,912,814 (GRCm39)	missense	probably benign	0.02
IGL01982:Bysl	APN	17	47,921,996 (GRCm39)	splice site	probably null
IGL03048:Bysl	APN	17	47,913,560 (GRCm39)	splice site	probably null
IGL03227:Bysl	APN	17	47,922,017 (GRCm39)	missense	probably benign	0.01
R0115:Bysl	UTSW	17	47,921,867 (GRCm39)	missense	probably benign
R0243:Bysl	UTSW	17	47,917,821 (GRCm39)	missense	possibly damaging	0.93
R0685:Bysl	UTSW	17	47,913,396 (GRCm39)	missense	probably benign	0.25
R2511:Bysl	UTSW	17	47,915,260 (GRCm39)	missense	probably benign
R5636:Bysl	UTSW	17	47,913,648 (GRCm39)	missense	probably benign	0.25
R6614:Bysl	UTSW	17	47,912,767 (GRCm39)	missense	probably damaging	1.00
R7311:Bysl	UTSW	17	47,912,710 (GRCm39)	missense	possibly damaging	0.75
R7463:Bysl	UTSW	17	47,913,396 (GRCm39)	missense	probably benign	0.25
R8861:Bysl	UTSW	17	47,917,884 (GRCm39)	missense	probably benign	0.01
R9114:Bysl	UTSW	17	47,915,242 (GRCm39)	missense
R9666:Bysl	UTSW	17	47,914,865 (GRCm39)	missense	probably benign	0.14
X0025:Bysl	UTSW	17	47,922,016 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AATCCTGTTCTGATCGCCATGG -3'
(R):5'- CAGCGTCCAGGGGAATTATAC -3'

Sequencing Primer
(F):5'- CTGATCGCCATGGCTTATTTG -3'
(R):5'- GTTGGGATTAAAGGCTTACACCACC -3'

Posted On

2015-06-10