Incidental Mutation 'R0394:Exoc7'
ID31881
Institutional Source Beutler Lab
Gene Symbol Exoc7
Ensembl Gene ENSMUSG00000020792
Gene Nameexocyst complex component 7
Synonymssec70, Exo70, 70kDa
MMRRC Submission 038600-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.773) question?
Stock #R0394 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location116288001-116307233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 116300398 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 219 (Q219K)
Ref Sequence ENSEMBL: ENSMUSP00000121794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021147] [ENSMUST00000106411] [ENSMUST00000106413] [ENSMUST00000124281] [ENSMUST00000126731] [ENSMUST00000133468]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021147
AA Change: Q226K

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021147
Gene: ENSMUSG00000020792
AA Change: Q226K

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 310 691 6.9e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106411
AA Change: Q226K

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102019
Gene: ENSMUSG00000020792
AA Change: Q226K

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 278 648 4e-82 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106413
AA Change: Q226K

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102021
Gene: ENSMUSG00000020792
AA Change: Q226K

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 309 679 6.4e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124281
Predicted Effect probably damaging
Transcript: ENSMUST00000126731
AA Change: Q219K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121794
Gene: ENSMUSG00000020792
AA Change: Q219K

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
PDB:2PFT|A 78 265 1e-113 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000133468
SMART Domains Protein: ENSMUSP00000121150
Gene: ENSMUSG00000020792

DomainStartEndE-ValueType
PDB:2PFT|A 63 105 3e-23 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139699
Meta Mutation Damage Score 0.234 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex. The exocyst complex plays a critical role in vesicular trafficking and the secretory pathway by targeting post-Golgi vesicles to the plasma membrane. The encoded protein is required for assembly of the exocyst complex and docking of the complex to the plasma membrane. The encoded protein may also play a role in pre-mRNA splicing through interactions with pre-mRNA-processing factor 19. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 4. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,067,304 S751R probably damaging Het
4933417A18Rik T C 13: 34,932,653 probably benign Het
Abca8a A G 11: 110,026,343 V1610A probably damaging Het
Actl10 A T 2: 154,553,037 H202L probably benign Het
Alox12 A T 11: 70,245,935 V489E probably damaging Het
Ap4m1 T A 5: 138,172,203 F5I probably benign Het
Atn1 T C 6: 124,749,733 probably benign Het
Atrnl1 T A 19: 57,673,176 N529K probably benign Het
B3gntl1 C T 11: 121,619,715 G336D probably damaging Het
Bmp1 G A 14: 70,490,034 A703V probably damaging Het
Brat1 T G 5: 140,718,386 L798R probably damaging Het
Cacna1c C T 6: 118,625,497 G1302R probably damaging Het
Cdr2 A T 7: 120,958,731 D190E probably benign Het
Cenpe T C 3: 135,216,425 probably benign Het
Clstn1 A G 4: 149,644,178 D687G probably benign Het
Coro1a A G 7: 126,700,640 F337L probably benign Het
Ddx49 T A 8: 70,296,925 I252F probably damaging Het
Dennd2a T A 6: 39,522,812 D273V possibly damaging Het
Derl2 A T 11: 71,014,561 F32I probably benign Het
Dmrta1 A G 4: 89,692,039 Y412C probably damaging Het
Dsg1a A G 18: 20,333,750 N559S probably damaging Het
Dusp26 G T 8: 31,091,959 R27L probably benign Het
Eif2ak3 T C 6: 70,885,218 I492T probably benign Het
F2r T C 13: 95,604,476 T184A probably damaging Het
Fbf1 G A 11: 116,152,462 probably benign Het
Fbxo28 A G 1: 182,317,015 M328T probably benign Het
Fsip2 T A 2: 82,991,075 D5717E possibly damaging Het
Gnpat C A 8: 124,880,225 S373R possibly damaging Het
Golgb1 G T 16: 36,875,579 probably benign Het
Greb1l T C 18: 10,523,374 V844A probably damaging Het
Hps1 G T 19: 42,770,899 probably null Het
Inppl1 G T 7: 101,828,195 probably benign Het
Isca1 C T 13: 59,758,885 probably null Het
Itgb2 T A 10: 77,542,475 C46S probably damaging Het
Kifc5b C T 17: 26,923,082 T178M probably benign Het
Krt80 T C 15: 101,352,299 T22A probably damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Ltbp2 C T 12: 84,806,424 probably benign Het
Mettl18 A G 1: 163,996,341 D77G probably benign Het
Mfsd2a A G 4: 122,950,168 L336P probably benign Het
Mgat4b A G 11: 50,230,919 probably null Het
Mtmr14 C T 6: 113,280,688 R233* probably null Het
Nbea T C 3: 56,029,907 Y761C probably damaging Het
Neb A T 2: 52,177,559 probably null Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Olfr814 T A 10: 129,873,942 I272L probably benign Het
Oxr1 T A 15: 41,817,197 M177K probably damaging Het
Pgm2l1 A G 7: 100,252,198 Y98C probably damaging Het
Pi4kb G T 3: 94,996,804 probably benign Het
Pi4kb G A 3: 94,996,805 probably benign Het
Pirb T A 7: 3,719,248 S199C probably benign Het
Prss23 A C 7: 89,509,847 I338S probably damaging Het
Rapgef3 A T 15: 97,757,819 probably benign Het
Rdh7 T A 10: 127,884,670 T278S probably benign Het
Rnf219 T C 14: 104,478,853 R695G possibly damaging Het
Rrp1b A G 17: 32,058,564 D606G probably benign Het
Rxfp1 T A 3: 79,652,377 Y379F possibly damaging Het
Rxfp2 T C 5: 150,067,388 V514A probably benign Het
Scel A T 14: 103,562,518 E202V probably benign Het
Slc25a36 G A 9: 97,080,204 A244V probably benign Het
Slc2a13 T G 15: 91,516,392 Q209P probably damaging Het
Slc38a6 A G 12: 73,352,530 N456S probably benign Het
Slc6a12 G T 6: 121,346,998 probably null Het
Spag6l T C 16: 16,780,629 I333V probably benign Het
Spen G A 4: 141,474,203 A2371V probably benign Het
St6galnac1 T C 11: 116,766,640 D366G probably damaging Het
Stk33 T C 7: 109,341,489 S5G probably benign Het
Tle2 T C 10: 81,577,648 L84P probably damaging Het
Tmem14a T C 1: 21,226,652 M78T probably damaging Het
Top2b T A 14: 16,413,556 probably null Het
Trmt13 A G 3: 116,582,650 F364S probably damaging Het
Unkl T A 17: 25,230,777 probably null Het
Uvrag A G 7: 99,004,719 probably benign Het
Vmn2r8 T A 5: 108,802,072 N303I probably benign Het
Vsig10l A G 7: 43,465,455 N360S probably damaging Het
Zdhhc25 T C 15: 88,600,920 Y153H probably damaging Het
Zfp646 T C 7: 127,883,262 V1537A possibly damaging Het
Zfp664 T A 5: 124,886,065 Y174* probably null Het
Other mutations in Exoc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01999:Exoc7 APN 11 116301100 splice site probably null
IGL02825:Exoc7 APN 11 116297585 missense probably damaging 0.98
IGL03068:Exoc7 APN 11 116301134 missense possibly damaging 0.70
IGL03333:Exoc7 APN 11 116301161 missense probably benign 0.17
IGL03412:Exoc7 APN 11 116289275 missense possibly damaging 0.57
IGL02799:Exoc7 UTSW 11 116301181 missense probably damaging 1.00
R0022:Exoc7 UTSW 11 116297582 missense possibly damaging 0.62
R0068:Exoc7 UTSW 11 116304906 missense probably damaging 1.00
R0158:Exoc7 UTSW 11 116295292 missense probably benign 0.01
R0362:Exoc7 UTSW 11 116295662 missense probably benign 0.37
R0387:Exoc7 UTSW 11 116294401 unclassified probably benign
R0714:Exoc7 UTSW 11 116293294 missense probably benign 0.16
R0848:Exoc7 UTSW 11 116295248 missense possibly damaging 0.93
R1611:Exoc7 UTSW 11 116295265 missense possibly damaging 0.84
R1795:Exoc7 UTSW 11 116292521 missense probably damaging 0.98
R2259:Exoc7 UTSW 11 116306411 missense probably damaging 1.00
R3911:Exoc7 UTSW 11 116306905 missense probably benign 0.12
R3913:Exoc7 UTSW 11 116306905 missense probably benign 0.12
R3979:Exoc7 UTSW 11 116296762 missense probably benign 0.30
R4029:Exoc7 UTSW 11 116306988 unclassified probably benign
R4576:Exoc7 UTSW 11 116289183 makesense probably null
R4983:Exoc7 UTSW 11 116289269 missense probably damaging 1.00
R5309:Exoc7 UTSW 11 116305027 nonsense probably null
R6453:Exoc7 UTSW 11 116293969 splice site probably null
X0063:Exoc7 UTSW 11 116304949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCATGAACTCCAGAAGGCTCAC -3'
(R):5'- ATGGCTCACCACCGCTTTTGAC -3'

Sequencing Primer
(F):5'- AAGGCTCACCCCAGAGTG -3'
(R):5'- cccaaagaggccagatgag -3'
Posted On2013-04-24