Incidental Mutation 'R4204:Sis'
ID 318817
Institutional Source Beutler Lab
Gene Symbol Sis
Ensembl Gene ENSMUSG00000027790
Gene Name sucrase isomaltase
Synonyms 2010204N08Rik, Si-s, sucrase-isomaltase
MMRRC Submission 041033-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4204 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 72795890-72875196 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72868415 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 92 (I92V)
Ref Sequence ENSEMBL: ENSMUSP00000129116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094190] [ENSMUST00000167334]
AlphaFold F8VQM5
Predicted Effect probably benign
Transcript: ENSMUST00000094190
AA Change: I92V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091742
Gene: ENSMUSG00000027790
AA Change: I92V

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167334
AA Change: I92V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129116
Gene: ENSMUSG00000027790
AA Change: I92V

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170445
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sucrase-isomaltase enzyme that is expressed in the intestinal brush border. The encoded protein is synthesized as a precursor protein that is cleaved by pancreatic proteases into two enzymatic subunits sucrase and isomaltase. These two subunits heterodimerize to form the sucrose-isomaltase complex. This complex is essential for the digestion of dietary carbohydrates including starch, sucrose and isomaltose. Mutations in this gene are the cause of congenital sucrase-isomaltase deficiency.[provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,090,369 (GRCm39) K360R probably benign Het
Ano7 A G 1: 93,308,200 (GRCm39) D77G probably benign Het
B130006D01Rik A G 11: 95,617,250 (GRCm39) probably benign Het
BC028528 A T 3: 95,797,057 (GRCm39) Y37* probably null Het
Ccdc171 A T 4: 83,599,392 (GRCm39) M736L probably benign Het
Ccdc88a A G 11: 29,413,399 (GRCm39) K646E probably damaging Het
Fam83b T C 9: 76,410,335 (GRCm39) T192A probably benign Het
Hgs C A 11: 120,368,013 (GRCm39) P241T probably damaging Het
Itga4 T C 2: 79,109,505 (GRCm39) Y235H probably damaging Het
Kank2 A G 9: 21,706,923 (GRCm39) Y32H probably damaging Het
Kprp A C 3: 92,732,046 (GRCm39) S335A probably damaging Het
Lgals9 C T 11: 78,860,642 (GRCm39) probably benign Het
Mfrp G A 9: 44,016,525 (GRCm39) G407S possibly damaging Het
Mfsd9 C T 1: 40,820,670 (GRCm39) G160R probably damaging Het
Mrtfb A T 16: 13,221,119 (GRCm39) Q776L possibly damaging Het
Mtcl1 T C 17: 66,745,256 (GRCm39) Y35C probably damaging Het
Nhej1 A T 1: 75,085,782 (GRCm39) I6N probably damaging Het
Npy5r G T 8: 67,134,693 (GRCm39) Y33* probably null Het
Or4c120 A G 2: 89,001,124 (GRCm39) V144A probably benign Het
Pcdha8 G C 18: 37,127,737 (GRCm39) V740L probably damaging Het
Pde8b C A 13: 95,359,053 (GRCm39) C90F probably benign Het
Pex14 T C 4: 149,047,984 (GRCm39) T198A probably benign Het
Ppp2r2b T A 18: 42,871,115 (GRCm39) H62L probably benign Het
Prodh A G 16: 17,890,182 (GRCm39) V553A probably damaging Het
Rasgef1c G A 11: 49,849,535 (GRCm39) V137M probably benign Het
Resf1 C T 6: 149,231,042 (GRCm39) R1363* probably null Het
Rgl2 G T 17: 34,155,906 (GRCm39) V694L probably benign Het
Rnf133 T C 6: 23,649,048 (GRCm39) N294D probably benign Het
Rpe65 G A 3: 159,310,047 (GRCm39) A107T probably damaging Het
Sacs A G 14: 61,410,892 (GRCm39) R56G possibly damaging Het
Serp2 A G 14: 76,793,902 (GRCm39) I18T probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Tcaim A G 9: 122,662,683 (GRCm39) K417R probably benign Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Tmem132c A G 5: 127,640,829 (GRCm39) D1000G possibly damaging Het
Trpm3 T A 19: 22,964,928 (GRCm39) D1474E probably benign Het
Ubxn2a T C 12: 4,944,593 (GRCm39) E43G probably damaging Het
Utp14b G A 1: 78,642,539 (GRCm39) E146K probably benign Het
Zfp800 C T 6: 28,243,180 (GRCm39) S595N probably benign Het
Other mutations in Sis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Sis APN 3 72,853,969 (GRCm39) missense probably benign
IGL00715:Sis APN 3 72,841,457 (GRCm39) missense probably damaging 1.00
IGL00721:Sis APN 3 72,850,912 (GRCm39) missense probably damaging 1.00
IGL00766:Sis APN 3 72,814,570 (GRCm39) splice site probably benign
IGL00783:Sis APN 3 72,853,965 (GRCm39) missense probably benign
IGL00805:Sis APN 3 72,841,532 (GRCm39) missense probably benign 0.05
IGL00932:Sis APN 3 72,848,289 (GRCm39) splice site probably benign
IGL01020:Sis APN 3 72,874,171 (GRCm39) missense probably damaging 1.00
IGL01024:Sis APN 3 72,819,209 (GRCm39) missense probably damaging 1.00
IGL01286:Sis APN 3 72,848,358 (GRCm39) missense probably damaging 1.00
IGL01457:Sis APN 3 72,868,354 (GRCm39) missense probably benign
IGL01514:Sis APN 3 72,843,253 (GRCm39) splice site probably benign
IGL01986:Sis APN 3 72,852,545 (GRCm39) missense probably damaging 1.00
IGL02110:Sis APN 3 72,836,032 (GRCm39) nonsense probably null
IGL02132:Sis APN 3 72,854,804 (GRCm39) missense probably benign 0.00
IGL02152:Sis APN 3 72,796,319 (GRCm39) utr 3 prime probably benign
IGL02200:Sis APN 3 72,850,937 (GRCm39) missense probably damaging 0.99
IGL02244:Sis APN 3 72,863,523 (GRCm39) missense probably benign 0.19
IGL02307:Sis APN 3 72,819,167 (GRCm39) splice site probably benign
IGL02374:Sis APN 3 72,832,789 (GRCm39) missense probably benign 0.03
IGL02437:Sis APN 3 72,826,947 (GRCm39) critical splice acceptor site probably null
IGL02571:Sis APN 3 72,863,637 (GRCm39) splice site probably benign
IGL02601:Sis APN 3 72,820,543 (GRCm39) missense probably benign 0.44
IGL03063:Sis APN 3 72,835,630 (GRCm39) missense probably benign
IGL03382:Sis APN 3 72,836,052 (GRCm39) missense probably benign 0.00
IGL03397:Sis APN 3 72,843,212 (GRCm39) missense probably benign 0.44
PIT1430001:Sis UTSW 3 72,830,162 (GRCm39) missense probably damaging 0.97
R0013:Sis UTSW 3 72,817,809 (GRCm39) missense possibly damaging 0.65
R0013:Sis UTSW 3 72,817,809 (GRCm39) missense possibly damaging 0.65
R0046:Sis UTSW 3 72,839,427 (GRCm39) missense probably benign 0.01
R0094:Sis UTSW 3 72,828,770 (GRCm39) missense probably damaging 1.00
R0096:Sis UTSW 3 72,835,600 (GRCm39) missense probably damaging 1.00
R0505:Sis UTSW 3 72,867,629 (GRCm39) missense probably benign 0.29
R0544:Sis UTSW 3 72,858,975 (GRCm39) missense probably damaging 1.00
R0551:Sis UTSW 3 72,832,740 (GRCm39) missense possibly damaging 0.79
R0617:Sis UTSW 3 72,872,938 (GRCm39) missense probably damaging 1.00
R0698:Sis UTSW 3 72,817,831 (GRCm39) missense probably damaging 1.00
R0701:Sis UTSW 3 72,848,378 (GRCm39) missense probably damaging 1.00
R0704:Sis UTSW 3 72,857,155 (GRCm39) missense possibly damaging 0.63
R0706:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0710:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0752:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0753:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0754:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0767:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0769:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0772:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0774:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0776:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0818:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0819:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0885:Sis UTSW 3 72,819,282 (GRCm39) nonsense probably null
R1076:Sis UTSW 3 72,841,431 (GRCm39) missense probably damaging 0.97
R1140:Sis UTSW 3 72,858,949 (GRCm39) missense probably damaging 0.98
R1175:Sis UTSW 3 72,865,437 (GRCm39) splice site probably benign
R1301:Sis UTSW 3 72,853,915 (GRCm39) missense possibly damaging 0.76
R1437:Sis UTSW 3 72,841,475 (GRCm39) missense probably damaging 1.00
R1466:Sis UTSW 3 72,839,393 (GRCm39) missense possibly damaging 0.60
R1466:Sis UTSW 3 72,839,393 (GRCm39) missense possibly damaging 0.60
R1472:Sis UTSW 3 72,796,360 (GRCm39) missense probably benign 0.12
R1584:Sis UTSW 3 72,839,393 (GRCm39) missense possibly damaging 0.60
R1707:Sis UTSW 3 72,816,420 (GRCm39) splice site probably benign
R1715:Sis UTSW 3 72,796,343 (GRCm39) missense possibly damaging 0.47
R1719:Sis UTSW 3 72,872,937 (GRCm39) missense probably damaging 1.00
R1728:Sis UTSW 3 72,872,978 (GRCm39) nonsense probably null
R1784:Sis UTSW 3 72,872,978 (GRCm39) nonsense probably null
R1820:Sis UTSW 3 72,828,475 (GRCm39) missense probably damaging 1.00
R1972:Sis UTSW 3 72,828,337 (GRCm39) missense probably damaging 1.00
R1973:Sis UTSW 3 72,828,337 (GRCm39) missense probably damaging 1.00
R2054:Sis UTSW 3 72,820,570 (GRCm39) missense probably benign 0.01
R2233:Sis UTSW 3 72,820,527 (GRCm39) missense probably benign 0.03
R2235:Sis UTSW 3 72,820,527 (GRCm39) missense probably benign 0.03
R2276:Sis UTSW 3 72,821,934 (GRCm39) nonsense probably null
R2435:Sis UTSW 3 72,819,237 (GRCm39) missense probably benign 0.01
R2885:Sis UTSW 3 72,816,506 (GRCm39) missense probably benign 0.01
R2966:Sis UTSW 3 72,796,343 (GRCm39) missense probably benign 0.30
R3708:Sis UTSW 3 72,850,856 (GRCm39) missense probably benign 0.02
R3790:Sis UTSW 3 72,828,747 (GRCm39) missense probably damaging 1.00
R3807:Sis UTSW 3 72,832,929 (GRCm39) missense probably benign 0.01
R3858:Sis UTSW 3 72,835,985 (GRCm39) missense probably damaging 0.99
R3974:Sis UTSW 3 72,850,968 (GRCm39) missense probably damaging 0.96
R3975:Sis UTSW 3 72,850,968 (GRCm39) missense probably damaging 0.96
R4037:Sis UTSW 3 72,835,935 (GRCm39) missense probably benign
R4080:Sis UTSW 3 72,828,517 (GRCm39) missense probably damaging 1.00
R4394:Sis UTSW 3 72,863,482 (GRCm39) missense probably damaging 1.00
R4470:Sis UTSW 3 72,835,492 (GRCm39) splice site probably null
R4573:Sis UTSW 3 72,835,570 (GRCm39) missense possibly damaging 0.94
R4868:Sis UTSW 3 72,850,881 (GRCm39) missense probably benign 0.09
R5023:Sis UTSW 3 72,841,455 (GRCm39) missense probably benign 0.05
R5264:Sis UTSW 3 72,857,089 (GRCm39) missense probably damaging 0.98
R5414:Sis UTSW 3 72,859,826 (GRCm39) missense probably benign
R5462:Sis UTSW 3 72,857,171 (GRCm39) missense probably damaging 0.96
R5523:Sis UTSW 3 72,798,754 (GRCm39) missense probably benign 0.00
R5584:Sis UTSW 3 72,817,748 (GRCm39) missense probably damaging 1.00
R5587:Sis UTSW 3 72,821,909 (GRCm39) missense possibly damaging 0.94
R5725:Sis UTSW 3 72,872,931 (GRCm39) missense probably damaging 1.00
R5769:Sis UTSW 3 72,835,568 (GRCm39) missense probably damaging 0.98
R5790:Sis UTSW 3 72,835,507 (GRCm39) missense probably benign
R5864:Sis UTSW 3 72,857,151 (GRCm39) missense probably damaging 1.00
R5902:Sis UTSW 3 72,867,589 (GRCm39) critical splice donor site probably null
R5925:Sis UTSW 3 72,828,713 (GRCm39) splice site probably null
R6018:Sis UTSW 3 72,820,525 (GRCm39) missense possibly damaging 0.95
R6029:Sis UTSW 3 72,835,641 (GRCm39) missense probably benign 0.30
R6124:Sis UTSW 3 72,860,544 (GRCm39) missense possibly damaging 0.69
R6171:Sis UTSW 3 72,868,360 (GRCm39) missense possibly damaging 0.75
R6182:Sis UTSW 3 72,811,626 (GRCm39) missense probably benign 0.05
R6295:Sis UTSW 3 72,874,103 (GRCm39) missense probably damaging 0.99
R6416:Sis UTSW 3 72,819,187 (GRCm39) missense probably damaging 1.00
R6431:Sis UTSW 3 72,865,507 (GRCm39) missense probably benign 0.00
R6472:Sis UTSW 3 72,846,067 (GRCm39) nonsense probably null
R6517:Sis UTSW 3 72,814,475 (GRCm39) missense probably damaging 1.00
R6701:Sis UTSW 3 72,856,860 (GRCm39) missense probably damaging 1.00
R6796:Sis UTSW 3 72,872,951 (GRCm39) missense probably benign 0.06
R6853:Sis UTSW 3 72,798,759 (GRCm39) missense possibly damaging 0.93
R6906:Sis UTSW 3 72,826,818 (GRCm39) missense probably damaging 1.00
R7058:Sis UTSW 3 72,810,940 (GRCm39) missense probably damaging 0.98
R7357:Sis UTSW 3 72,832,404 (GRCm39) missense probably damaging 1.00
R7381:Sis UTSW 3 72,820,625 (GRCm39) splice site probably null
R7439:Sis UTSW 3 72,816,374 (GRCm39) missense possibly damaging 0.81
R7742:Sis UTSW 3 72,832,431 (GRCm39) missense probably benign 0.19
R7813:Sis UTSW 3 72,832,801 (GRCm39) missense probably benign 0.01
R7883:Sis UTSW 3 72,828,329 (GRCm39) missense possibly damaging 0.78
R7899:Sis UTSW 3 72,844,584 (GRCm39) missense probably damaging 1.00
R7915:Sis UTSW 3 72,828,471 (GRCm39) missense probably damaging 0.99
R7985:Sis UTSW 3 72,844,294 (GRCm39) splice site probably null
R8020:Sis UTSW 3 72,816,298 (GRCm39) critical splice donor site probably null
R8023:Sis UTSW 3 72,859,813 (GRCm39) missense probably damaging 0.97
R8029:Sis UTSW 3 72,828,475 (GRCm39) missense probably damaging 1.00
R8053:Sis UTSW 3 72,856,901 (GRCm39) nonsense probably null
R8062:Sis UTSW 3 72,828,321 (GRCm39) nonsense probably null
R8074:Sis UTSW 3 72,824,531 (GRCm39) missense probably damaging 1.00
R8085:Sis UTSW 3 72,814,462 (GRCm39) missense probably damaging 1.00
R8137:Sis UTSW 3 72,796,378 (GRCm39) missense probably benign 0.22
R8349:Sis UTSW 3 72,810,984 (GRCm39) missense probably damaging 1.00
R8354:Sis UTSW 3 72,854,834 (GRCm39) missense possibly damaging 0.84
R8366:Sis UTSW 3 72,865,566 (GRCm39) missense probably damaging 1.00
R8449:Sis UTSW 3 72,810,984 (GRCm39) missense probably damaging 1.00
R8454:Sis UTSW 3 72,854,834 (GRCm39) missense possibly damaging 0.84
R8474:Sis UTSW 3 72,836,730 (GRCm39) missense probably damaging 1.00
R8515:Sis UTSW 3 72,836,742 (GRCm39) missense probably benign 0.00
R8680:Sis UTSW 3 72,867,628 (GRCm39) missense probably damaging 1.00
R8703:Sis UTSW 3 72,867,657 (GRCm39) missense probably damaging 1.00
R9098:Sis UTSW 3 72,844,578 (GRCm39) missense possibly damaging 0.66
R9466:Sis UTSW 3 72,872,910 (GRCm39) critical splice donor site probably null
R9574:Sis UTSW 3 72,828,490 (GRCm39) missense probably benign 0.05
R9630:Sis UTSW 3 72,828,722 (GRCm39) missense probably benign 0.11
R9680:Sis UTSW 3 72,863,621 (GRCm39) missense probably benign 0.12
R9709:Sis UTSW 3 72,799,074 (GRCm39) missense possibly damaging 0.47
R9731:Sis UTSW 3 72,835,543 (GRCm39) missense probably benign 0.01
X0009:Sis UTSW 3 72,796,355 (GRCm39) missense probably damaging 0.99
X0024:Sis UTSW 3 72,836,003 (GRCm39) missense probably benign
X0060:Sis UTSW 3 72,828,239 (GRCm39) intron probably benign
Z1176:Sis UTSW 3 72,850,890 (GRCm39) missense probably benign 0.25
Z1176:Sis UTSW 3 72,811,606 (GRCm39) missense probably benign 0.05
Z1177:Sis UTSW 3 72,850,902 (GRCm39) missense probably damaging 1.00
Z1177:Sis UTSW 3 72,817,807 (GRCm39) missense probably damaging 1.00
Z1177:Sis UTSW 3 72,816,505 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CTGCTACAAATGACACGCTG -3'
(R):5'- CAAAGGGTCTTAAAAGGTGTGTGC -3'

Sequencing Primer
(F):5'- AGAGGCCTCTTGGTATTGCAAAC -3'
(R):5'- AAAGGTGTGTGCTTAGAGTATTAATG -3'
Posted On 2015-06-10