Incidental Mutation 'R4204:2810474O19Rik'
ID318829
Institutional Source Beutler Lab
Gene Symbol 2810474O19Rik
Ensembl Gene ENSMUSG00000032712
Gene NameRIKEN cDNA 2810474O19 gene
SynonymsGET
MMRRC Submission 041033-MU
Accession Numbers

Genbank: NM_026054; MGI: 1914496

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4204 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location149309414-149335663 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 149329544 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 1363 (R1363*)
Ref Sequence ENSEMBL: ENSMUSP00000140026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046689] [ENSMUST00000100765] [ENSMUST00000127680] [ENSMUST00000130664] [ENSMUST00000185930] [ENSMUST00000187881] [ENSMUST00000189837] [ENSMUST00000189932] [ENSMUST00000190785]
Predicted Effect probably null
Transcript: ENSMUST00000046689
AA Change: R1363*
SMART Domains Protein: ENSMUSP00000041180
Gene: ENSMUSG00000032712
AA Change: R1363*

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100765
AA Change: R1363*
SMART Domains Protein: ENSMUSP00000098328
Gene: ENSMUSG00000032712
AA Change: R1363*

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127680
Predicted Effect probably benign
Transcript: ENSMUST00000130664
Predicted Effect probably benign
Transcript: ENSMUST00000185930
Predicted Effect probably benign
Transcript: ENSMUST00000187881
Predicted Effect probably null
Transcript: ENSMUST00000189837
AA Change: R1363*
SMART Domains Protein: ENSMUSP00000139660
Gene: ENSMUSG00000032712
AA Change: R1363*

DomainStartEndE-ValueType
Pfam:DUF4617 451 1511 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000189932
AA Change: R1363*
SMART Domains Protein: ENSMUSP00000140026
Gene: ENSMUSG00000032712
AA Change: R1363*

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190785
SMART Domains Protein: ENSMUSP00000139624
Gene: ENSMUSG00000032712

DomainStartEndE-ValueType
Pfam:DUF4617 451 1173 9.4e-255 PFAM
Meta Mutation Damage Score 0.6456 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (46/47)
Allele List at MGI

All alleles(126) : Targeted, knock-out(1) Gene trapped(125)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,090,369 K360R probably benign Het
Ano7 A G 1: 93,380,478 D77G probably benign Het
B130006D01Rik A G 11: 95,726,424 probably benign Het
BC028528 A T 3: 95,889,745 Y37* probably null Het
Ccdc171 A T 4: 83,681,155 M736L probably benign Het
Ccdc88a A G 11: 29,463,399 K646E probably damaging Het
Fam83b T C 9: 76,503,053 T192A probably benign Het
Hgs C A 11: 120,477,187 P241T probably damaging Het
Itga4 T C 2: 79,279,161 Y235H probably damaging Het
Kank2 A G 9: 21,795,627 Y32H probably damaging Het
Kprp A C 3: 92,824,739 S335A probably damaging Het
Lgals9 C T 11: 78,969,816 probably benign Het
Mfrp G A 9: 44,105,228 G407S possibly damaging Het
Mfsd9 C T 1: 40,781,510 G160R probably damaging Het
Mkl2 A T 16: 13,403,255 Q776L possibly damaging Het
Mtcl1 T C 17: 66,438,261 Y35C probably damaging Het
Nhej1 A T 1: 75,046,623 I6N probably damaging Het
Npy5r G T 8: 66,682,041 Y33* probably null Het
Olfr1225 A G 2: 89,170,780 V144A probably benign Het
Pcdha8 G C 18: 36,994,684 V740L probably damaging Het
Pde8b C A 13: 95,222,545 C90F probably benign Het
Pex14 T C 4: 148,963,527 T198A probably benign Het
Ppp2r2b T A 18: 42,738,050 H62L probably benign Het
Prodh A G 16: 18,072,318 V553A probably damaging Het
Rasgef1c G A 11: 49,958,708 V137M probably benign Het
Rgl2 G T 17: 33,936,932 V694L probably benign Het
Rnf133 T C 6: 23,649,049 N294D probably benign Het
Rpe65 G A 3: 159,604,410 A107T probably damaging Het
Sacs A G 14: 61,173,443 R56G possibly damaging Het
Serp2 A G 14: 76,556,462 I18T probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sis T C 3: 72,961,082 I92V probably benign Het
Tcaim A G 9: 122,833,618 K417R probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmem132c A G 5: 127,563,765 D1000G possibly damaging Het
Trpm3 T A 19: 22,987,564 D1474E probably benign Het
Ubxn2a T C 12: 4,894,593 E43G probably damaging Het
Utp14b G A 1: 78,664,822 E146K probably benign Het
Zfp800 C T 6: 28,243,181 S595N probably benign Het
Other mutations in 2810474O19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:2810474O19Rik APN 6 149334750 utr 3 prime probably benign
IGL01401:2810474O19Rik APN 6 149326896 missense probably damaging 0.98
IGL01461:2810474O19Rik APN 6 149331515 unclassified probably benign
IGL01610:2810474O19Rik APN 6 149328951 missense probably benign 0.01
IGL02873:2810474O19Rik APN 6 149327040 missense probably damaging 1.00
IGL03202:2810474O19Rik APN 6 149326439 missense probably benign 0.08
grand_junction UTSW 6 149327878 missense probably damaging 0.98
grand_marais UTSW 6 149326460 nonsense probably null
3-1:2810474O19Rik UTSW 6 149327729 missense probably damaging 0.98
B6584:2810474O19Rik UTSW 6 149329346 missense probably damaging 0.96
PIT4280001:2810474O19Rik UTSW 6 149325525 missense probably benign 0.23
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0243:2810474O19Rik UTSW 6 149326241 missense probably damaging 1.00
R0620:2810474O19Rik UTSW 6 149328375 missense probably damaging 1.00
R0633:2810474O19Rik UTSW 6 149325701 missense probably benign 0.00
R0727:2810474O19Rik UTSW 6 149325822 missense possibly damaging 0.94
R0904:2810474O19Rik UTSW 6 149328269 missense probably damaging 0.99
R1221:2810474O19Rik UTSW 6 149326221 missense probably benign 0.24
R1282:2810474O19Rik UTSW 6 149329172 nonsense probably null
R1435:2810474O19Rik UTSW 6 149326082 missense probably benign 0.04
R1452:2810474O19Rik UTSW 6 149326632 missense probably damaging 1.00
R1587:2810474O19Rik UTSW 6 149326520 missense probably damaging 1.00
R1912:2810474O19Rik UTSW 6 149328844 missense possibly damaging 0.80
R1926:2810474O19Rik UTSW 6 149329404 missense probably benign 0.39
R1978:2810474O19Rik UTSW 6 149326432 missense probably damaging 0.97
R2035:2810474O19Rik UTSW 6 149329226 missense possibly damaging 0.91
R2136:2810474O19Rik UTSW 6 149328822 missense probably benign 0.01
R2333:2810474O19Rik UTSW 6 149327511 missense probably damaging 1.00
R2360:2810474O19Rik UTSW 6 149334647 missense probably benign 0.05
R3027:2810474O19Rik UTSW 6 149329035 missense probably benign 0.02
R3121:2810474O19Rik UTSW 6 149329243 nonsense probably null
R3707:2810474O19Rik UTSW 6 149329113 missense probably damaging 0.98
R4247:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4249:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4304:2810474O19Rik UTSW 6 149326238 nonsense probably null
R4385:2810474O19Rik UTSW 6 149326208 missense possibly damaging 0.93
R4702:2810474O19Rik UTSW 6 149329403 missense probably benign 0.05
R4747:2810474O19Rik UTSW 6 149326894 missense probably damaging 0.96
R4912:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4913:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4965:2810474O19Rik UTSW 6 149328398 nonsense probably null
R4971:2810474O19Rik UTSW 6 149325599 unclassified probably benign
R5077:2810474O19Rik UTSW 6 149326030 missense probably benign 0.14
R5213:2810474O19Rik UTSW 6 149326053 missense possibly damaging 0.77
R5382:2810474O19Rik UTSW 6 149326460 nonsense probably null
R5418:2810474O19Rik UTSW 6 149326136 missense probably damaging 1.00
R5452:2810474O19Rik UTSW 6 149329113 nonsense probably null
R5498:2810474O19Rik UTSW 6 149328240 missense probably damaging 0.99
R5673:2810474O19Rik UTSW 6 149327993 nonsense probably null
R5690:2810474O19Rik UTSW 6 149328237 missense possibly damaging 0.95
R5916:2810474O19Rik UTSW 6 149326578 missense probably damaging 0.99
R5917:2810474O19Rik UTSW 6 149334681 missense probably damaging 0.98
R6160:2810474O19Rik UTSW 6 149331507 critical splice donor site probably null
R6280:2810474O19Rik UTSW 6 149327057 missense probably damaging 1.00
R6326:2810474O19Rik UTSW 6 149328995 missense probably damaging 0.96
R6396:2810474O19Rik UTSW 6 149327919 missense probably damaging 1.00
R6702:2810474O19Rik UTSW 6 149327878 missense probably damaging 0.98
R6972:2810474O19Rik UTSW 6 149326109 missense probably damaging 0.99
R7127:2810474O19Rik UTSW 6 149327945 missense possibly damaging 0.95
R7168:2810474O19Rik UTSW 6 149327843 missense probably benign
R7316:2810474O19Rik UTSW 6 149326638 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGATCCATCACTCTGAGGCG -3'
(R):5'- GGTGCTTGCTCTTTCTCAGGAC -3'

Sequencing Primer
(F):5'- TCACTCTGAGGCGTCTAGAAC -3'
(R):5'- ACAATCCTGCTTGTCAACAGTG -3'
Posted On2015-06-10