Incidental Mutation 'R4205:Ano7'
ID318854
Institutional Source Beutler Lab
Gene Symbol Ano7
Ensembl Gene ENSMUSG00000034107
Gene Nameanoctamin 7
SynonymsTmem16g, NGEP-L, IPCA-5, NGEP, Pcanap5
MMRRC Submission 041034-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R4205 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location93373930-93404303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93380478 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 77 (D77G)
Ref Sequence ENSEMBL: ENSMUSP00000140438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058682] [ENSMUST00000186641]
Predicted Effect probably benign
Transcript: ENSMUST00000058682
AA Change: D77G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000050495
Gene: ENSMUSG00000034107
AA Change: D77G

DomainStartEndE-ValueType
Pfam:Anoct_dimer 49 274 2.2e-63 PFAM
Pfam:Anoctamin 277 824 3.4e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186641
AA Change: D77G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000140438
Gene: ENSMUSG00000034107
AA Change: D77G

DomainStartEndE-ValueType
Pfam:Anoctamin 277 825 6.6e-150 PFAM
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a member of the anoctamin family, which in mammals is comprised of 10 members. Anoctamin proteins are proposed to have eight transmembrane domains with both termini facing the cytoplasm and a C-terminal domain of unknown function. While some members have been characterized as calcium-activated chloride channels, this protein is reported to have little anion conductance activity. In humans, this protein is primarily found in prostate tissues and may serve as a target for prostate cancer immunotherapy. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,610,919 I294T probably benign Het
Alpk2 G A 18: 65,305,211 T1037M possibly damaging Het
Arhgef5 A G 6: 43,273,832 T506A possibly damaging Het
Bclaf3 T A X: 159,553,833 S419T probably damaging Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cdhr1 G T 14: 37,080,504 F667L probably benign Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Dmrtc2 C T 7: 24,875,806 Q275* probably null Het
Dsg1b A T 18: 20,408,821 D795V probably damaging Het
Elavl1 A G 8: 4,289,851 W244R probably damaging Het
Emilin1 T C 5: 30,919,899 probably benign Het
Fam20c T G 5: 138,755,676 L14R probably damaging Het
Glt1d1 G T 5: 127,689,871 R217L probably benign Het
Gm13762 A G 2: 88,973,138 V251A probably benign Het
Gm498 G T 7: 143,869,227 V17L probably damaging Het
Klk14 G A 7: 43,694,934 R223H probably benign Het
Lrrc26 G T 2: 25,290,158 C57F probably damaging Het
Maml1 A T 11: 50,257,913 L1000Q probably damaging Het
Map2 A G 1: 66,425,290 Y125C probably damaging Het
Mapk1 T C 16: 17,038,457 probably benign Het
Mocos G A 18: 24,666,191 V161M possibly damaging Het
Pcdhgb5 A G 18: 37,732,663 N504D possibly damaging Het
Pcx G A 19: 4,619,166 V731M possibly damaging Het
Ppfibp1 C A 6: 147,029,581 S878R probably damaging Het
Ptprh C A 7: 4,597,992 G129W probably damaging Het
Rasal1 T C 5: 120,659,563 V120A probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Rtn4rl1 A T 11: 75,265,983 I414F probably damaging Het
Rtn4rl1 C A 11: 75,265,992 P417T probably damaging Het
Shank3 T C 15: 89,503,318 L230P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Taar9 C T 10: 24,108,579 R319H possibly damaging Het
Tbck T A 3: 132,838,028 I880N probably benign Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Zc3h13 A G 14: 75,327,601 D718G unknown Het
Other mutations in Ano7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ano7 APN 1 93402166 missense probably benign 0.04
IGL00838:Ano7 APN 1 93402757 missense possibly damaging 0.91
IGL01295:Ano7 APN 1 93380478 missense probably benign 0.00
IGL01322:Ano7 APN 1 93395508 missense probably benign 0.08
IGL01807:Ano7 APN 1 93402696 missense possibly damaging 0.66
IGL01859:Ano7 APN 1 93394446 missense probably damaging 1.00
IGL02349:Ano7 APN 1 93391490 missense probably benign 0.02
IGL02976:Ano7 APN 1 93402673 missense possibly damaging 0.78
R0360:Ano7 UTSW 1 93388658 missense probably benign 0.01
R0364:Ano7 UTSW 1 93388658 missense probably benign 0.01
R0528:Ano7 UTSW 1 93395502 missense probably null 1.00
R0741:Ano7 UTSW 1 93401587 missense probably damaging 0.97
R1131:Ano7 UTSW 1 93401776 missense probably benign 0.24
R1156:Ano7 UTSW 1 93401852 unclassified probably null
R1500:Ano7 UTSW 1 93397328 missense probably damaging 1.00
R1710:Ano7 UTSW 1 93385624 missense probably benign 0.00
R2002:Ano7 UTSW 1 93400581 unclassified probably benign
R2062:Ano7 UTSW 1 93390313 missense probably benign
R2120:Ano7 UTSW 1 93402133 splice site probably benign
R2200:Ano7 UTSW 1 93380436 missense possibly damaging 0.93
R2268:Ano7 UTSW 1 93380439 missense possibly damaging 0.51
R2763:Ano7 UTSW 1 93399186 splice site probably null
R4202:Ano7 UTSW 1 93380478 missense probably benign 0.00
R4204:Ano7 UTSW 1 93380478 missense probably benign 0.00
R4453:Ano7 UTSW 1 93394353 missense probably damaging 1.00
R4627:Ano7 UTSW 1 93375185 missense probably benign 0.15
R4735:Ano7 UTSW 1 93400494 missense probably benign
R4809:Ano7 UTSW 1 93394566 missense probably benign 0.20
R4935:Ano7 UTSW 1 93395314 missense possibly damaging 0.48
R4970:Ano7 UTSW 1 93397363 missense possibly damaging 0.77
R5112:Ano7 UTSW 1 93397363 missense possibly damaging 0.77
R5249:Ano7 UTSW 1 93375196 missense probably benign
R5813:Ano7 UTSW 1 93384919 critical splice donor site probably null
R6181:Ano7 UTSW 1 93395359 missense probably damaging 1.00
R7113:Ano7 UTSW 1 93385620 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GAAACCCATGGCTCTCACTTC -3'
(R):5'- TGCTTCATATCCTTGGGCAG -3'

Sequencing Primer
(F):5'- GCATCCCTGCTGAGACCAC -3'
(R):5'- TCATATCCTTGGGCAGTAAGC -3'
Posted On2015-06-10