Incidental Mutation 'R0394:Golgb1'
ID31899
Institutional Source Beutler Lab
Gene Symbol Golgb1
Ensembl Gene ENSMUSG00000034243
Gene Namegolgi autoantigen, golgin subfamily b, macrogolgin 1
SynonymsGiantin, C130074L01Rik, F730017E11Rik, Gm6840, 6330407A06Rik
MMRRC Submission 038600-MU
Accession Numbers

Genbank: NM_030035.1

Is this an essential gene? Possibly non essential (E-score: 0.483) question?
Stock #R0394 (G1)
Quality Score200
Status Validated
Chromosome16
Chromosomal Location36875140-36933085 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 36875579 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023534] [ENSMUST00000023535] [ENSMUST00000075946] [ENSMUST00000114812] [ENSMUST00000114819] [ENSMUST00000134616] [ENSMUST00000135406]
Predicted Effect unknown
Transcript: ENSMUST00000023534
AA Change: G147W
SMART Domains Protein: ENSMUSP00000023534
Gene: ENSMUSG00000034243
AA Change: G147W

DomainStartEndE-ValueType
low complexity region 55 99 N/A INTRINSIC
low complexity region 109 126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023535
SMART Domains Protein: ENSMUSP00000023535
Gene: ENSMUSG00000022837

DomainStartEndE-ValueType
IQ 293 315 5.92e-4 SMART
low complexity region 341 358 N/A INTRINSIC
IQ 386 408 2.66e-6 SMART
low complexity region 428 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075946
SMART Domains Protein: ENSMUSP00000075331
Gene: ENSMUSG00000022838

DomainStartEndE-ValueType
low complexity region 44 71 N/A INTRINSIC
low complexity region 117 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114812
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114819
SMART Domains Protein: ENSMUSP00000110467
Gene: ENSMUSG00000022837

DomainStartEndE-ValueType
IQ 293 315 5.92e-4 SMART
low complexity region 341 358 N/A INTRINSIC
IQ 386 408 2.66e-6 SMART
low complexity region 428 442 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134556
Predicted Effect probably benign
Transcript: ENSMUST00000134616
SMART Domains Protein: ENSMUSP00000116503
Gene: ENSMUSG00000034243

DomainStartEndE-ValueType
coiled coil region 42 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135406
SMART Domains Protein: ENSMUSP00000115848
Gene: ENSMUSG00000034243

DomainStartEndE-ValueType
coiled coil region 42 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157072
Meta Mutation Damage Score 0.0792 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (79/80)
MGI Phenotype PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,067,304 S751R probably damaging Het
4933417A18Rik T C 13: 34,932,653 probably benign Het
Abca8a A G 11: 110,026,343 V1610A probably damaging Het
Actl10 A T 2: 154,553,037 H202L probably benign Het
Alox12 A T 11: 70,245,935 V489E probably damaging Het
Ap4m1 T A 5: 138,172,203 F5I probably benign Het
Atn1 T C 6: 124,749,733 probably benign Het
Atrnl1 T A 19: 57,673,176 N529K probably benign Het
B3gntl1 C T 11: 121,619,715 G336D probably damaging Het
Bmp1 G A 14: 70,490,034 A703V probably damaging Het
Brat1 T G 5: 140,718,386 L798R probably damaging Het
Cacna1c C T 6: 118,625,497 G1302R probably damaging Het
Cdr2 A T 7: 120,958,731 D190E probably benign Het
Cenpe T C 3: 135,216,425 probably benign Het
Clstn1 A G 4: 149,644,178 D687G probably benign Het
Coro1a A G 7: 126,700,640 F337L probably benign Het
Ddx49 T A 8: 70,296,925 I252F probably damaging Het
Dennd2a T A 6: 39,522,812 D273V possibly damaging Het
Derl2 A T 11: 71,014,561 F32I probably benign Het
Dmrta1 A G 4: 89,692,039 Y412C probably damaging Het
Dsg1a A G 18: 20,333,750 N559S probably damaging Het
Dusp26 G T 8: 31,091,959 R27L probably benign Het
Eif2ak3 T C 6: 70,885,218 I492T probably benign Het
Exoc7 G T 11: 116,300,398 Q219K probably damaging Het
F2r T C 13: 95,604,476 T184A probably damaging Het
Fbf1 G A 11: 116,152,462 probably benign Het
Fbxo28 A G 1: 182,317,015 M328T probably benign Het
Fsip2 T A 2: 82,991,075 D5717E possibly damaging Het
Gnpat C A 8: 124,880,225 S373R possibly damaging Het
Greb1l T C 18: 10,523,374 V844A probably damaging Het
Hps1 G T 19: 42,770,899 probably null Het
Inppl1 G T 7: 101,828,195 probably benign Het
Isca1 C T 13: 59,758,885 probably null Het
Itgb2 T A 10: 77,542,475 C46S probably damaging Het
Kifc5b C T 17: 26,923,082 T178M probably benign Het
Krt80 T C 15: 101,352,299 T22A probably damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Ltbp2 C T 12: 84,806,424 probably benign Het
Mettl18 A G 1: 163,996,341 D77G probably benign Het
Mfsd2a A G 4: 122,950,168 L336P probably benign Het
Mgat4b A G 11: 50,230,919 probably null Het
Mtmr14 C T 6: 113,280,688 R233* probably null Het
Nbea T C 3: 56,029,907 Y761C probably damaging Het
Neb A T 2: 52,177,559 probably null Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Olfr814 T A 10: 129,873,942 I272L probably benign Het
Oxr1 T A 15: 41,817,197 M177K probably damaging Het
Pgm2l1 A G 7: 100,252,198 Y98C probably damaging Het
Pi4kb G T 3: 94,996,804 probably benign Het
Pi4kb G A 3: 94,996,805 probably benign Het
Pirb T A 7: 3,719,248 S199C probably benign Het
Prss23 A C 7: 89,509,847 I338S probably damaging Het
Rapgef3 A T 15: 97,757,819 probably benign Het
Rdh7 T A 10: 127,884,670 T278S probably benign Het
Rnf219 T C 14: 104,478,853 R695G possibly damaging Het
Rrp1b A G 17: 32,058,564 D606G probably benign Het
Rxfp1 T A 3: 79,652,377 Y379F possibly damaging Het
Rxfp2 T C 5: 150,067,388 V514A probably benign Het
Scel A T 14: 103,562,518 E202V probably benign Het
Slc25a36 G A 9: 97,080,204 A244V probably benign Het
Slc2a13 T G 15: 91,516,392 Q209P probably damaging Het
Slc38a6 A G 12: 73,352,530 N456S probably benign Het
Slc6a12 G T 6: 121,346,998 probably null Het
Spag6l T C 16: 16,780,629 I333V probably benign Het
Spen G A 4: 141,474,203 A2371V probably benign Het
St6galnac1 T C 11: 116,766,640 D366G probably damaging Het
Stk33 T C 7: 109,341,489 S5G probably benign Het
Tle2 T C 10: 81,577,648 L84P probably damaging Het
Tmem14a T C 1: 21,226,652 M78T probably damaging Het
Top2b T A 14: 16,413,556 probably null Het
Trmt13 A G 3: 116,582,650 F364S probably damaging Het
Unkl T A 17: 25,230,777 probably null Het
Uvrag A G 7: 99,004,719 probably benign Het
Vmn2r8 T A 5: 108,802,072 N303I probably benign Het
Vsig10l A G 7: 43,465,455 N360S probably damaging Het
Zdhhc25 T C 15: 88,600,920 Y153H probably damaging Het
Zfp646 T C 7: 127,883,262 V1537A possibly damaging Het
Zfp664 T A 5: 124,886,065 Y174* probably null Het
Other mutations in Golgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Golgb1 APN 16 36931564 missense probably damaging 1.00
IGL01717:Golgb1 APN 16 36915502 nonsense probably null
IGL01965:Golgb1 APN 16 36917920 missense probably damaging 1.00
IGL02128:Golgb1 APN 16 36916304 missense probably damaging 1.00
IGL02268:Golgb1 APN 16 36913128 missense probably benign 0.25
IGL02383:Golgb1 APN 16 36886200 missense probably benign 0.01
IGL02444:Golgb1 APN 16 36907816 splice site probably benign
IGL02635:Golgb1 APN 16 36915013 missense probably benign 0.00
IGL02655:Golgb1 APN 16 36918080 missense probably damaging 0.98
IGL02887:Golgb1 APN 16 36925849 missense probably damaging 0.99
IGL02937:Golgb1 APN 16 36916210 missense probably damaging 1.00
IGL02973:Golgb1 APN 16 36912080 missense possibly damaging 0.92
IGL02982:Golgb1 APN 16 36925810 missense probably damaging 0.98
IGL03065:Golgb1 APN 16 36912866 missense probably benign 0.11
IGL03109:Golgb1 APN 16 36915611 missense possibly damaging 0.93
IGL03323:Golgb1 APN 16 36913453 nonsense probably null
I2288:Golgb1 UTSW 16 36898542 missense probably benign 0.00
I2289:Golgb1 UTSW 16 36898542 missense probably benign 0.00
R0071:Golgb1 UTSW 16 36915503 missense probably benign 0.00
R0071:Golgb1 UTSW 16 36915503 missense probably benign 0.00
R0080:Golgb1 UTSW 16 36898611 missense probably damaging 1.00
R0102:Golgb1 UTSW 16 36875468 intron probably benign
R0242:Golgb1 UTSW 16 36875630 nonsense probably null
R0242:Golgb1 UTSW 16 36875630 nonsense probably null
R0276:Golgb1 UTSW 16 36913876 missense probably damaging 1.00
R0469:Golgb1 UTSW 16 36931635 missense probably benign 0.41
R0522:Golgb1 UTSW 16 36915205 frame shift probably null
R0575:Golgb1 UTSW 16 36918809 missense probably benign
R0600:Golgb1 UTSW 16 36916271 missense probably damaging 1.00
R0608:Golgb1 UTSW 16 36916330 nonsense probably null
R0711:Golgb1 UTSW 16 36918790 missense probably damaging 1.00
R0785:Golgb1 UTSW 16 36898790 missense possibly damaging 0.95
R0893:Golgb1 UTSW 16 36912277 missense possibly damaging 0.64
R1163:Golgb1 UTSW 16 36916126 missense possibly damaging 0.50
R1208:Golgb1 UTSW 16 36915205 frame shift probably null
R1315:Golgb1 UTSW 16 36914900 missense probably benign 0.40
R1429:Golgb1 UTSW 16 36900563 missense possibly damaging 0.93
R1505:Golgb1 UTSW 16 36919643 missense possibly damaging 0.79
R1537:Golgb1 UTSW 16 36898788 missense possibly damaging 0.89
R1610:Golgb1 UTSW 16 36926101 missense probably benign 0.25
R1659:Golgb1 UTSW 16 36887617 missense probably benign 0.01
R1769:Golgb1 UTSW 16 36916001 missense probably damaging 1.00
R2105:Golgb1 UTSW 16 36914664 missense probably benign
R2212:Golgb1 UTSW 16 36887347 missense probably damaging 1.00
R2261:Golgb1 UTSW 16 36893360 missense probably damaging 1.00
R2352:Golgb1 UTSW 16 36898559 missense probably damaging 0.99
R2357:Golgb1 UTSW 16 36912008 missense probably damaging 1.00
R2400:Golgb1 UTSW 16 36918466 missense possibly damaging 0.62
R2513:Golgb1 UTSW 16 36915151 missense possibly damaging 0.73
R3103:Golgb1 UTSW 16 36894849 missense probably damaging 1.00
R3413:Golgb1 UTSW 16 36887347 missense probably damaging 1.00
R3748:Golgb1 UTSW 16 36918912 missense probably benign 0.00
R3847:Golgb1 UTSW 16 36898733 missense probably benign 0.00
R3850:Golgb1 UTSW 16 36898733 missense probably benign 0.00
R3936:Golgb1 UTSW 16 36914056 nonsense probably null
R3975:Golgb1 UTSW 16 36918571 missense probably damaging 0.99
R4025:Golgb1 UTSW 16 36915344 missense probably benign 0.00
R4369:Golgb1 UTSW 16 36916907 missense probably damaging 1.00
R4518:Golgb1 UTSW 16 36929263 missense probably damaging 0.98
R4600:Golgb1 UTSW 16 36918625 missense probably damaging 1.00
R4610:Golgb1 UTSW 16 36918625 missense probably damaging 1.00
R4660:Golgb1 UTSW 16 36887618 missense probably damaging 0.99
R4811:Golgb1 UTSW 16 36891419 missense probably damaging 1.00
R4815:Golgb1 UTSW 16 36913115 missense possibly damaging 0.79
R4835:Golgb1 UTSW 16 36891407 missense possibly damaging 0.86
R4904:Golgb1 UTSW 16 36893386 missense probably damaging 1.00
R4916:Golgb1 UTSW 16 36916118 missense probably benign 0.05
R5121:Golgb1 UTSW 16 36919258 missense probably damaging 0.99
R5133:Golgb1 UTSW 16 36891457 missense possibly damaging 0.75
R5143:Golgb1 UTSW 16 36898689 missense probably benign 0.09
R5185:Golgb1 UTSW 16 36875141 unclassified probably benign
R5188:Golgb1 UTSW 16 36918465 missense probably benign 0.13
R5260:Golgb1 UTSW 16 36913141 missense probably benign 0.00
R5297:Golgb1 UTSW 16 36875616 intron probably benign
R5386:Golgb1 UTSW 16 36912315 nonsense probably null
R5438:Golgb1 UTSW 16 36900508 missense probably benign 0.15
R5439:Golgb1 UTSW 16 36900508 missense probably benign 0.15
R5494:Golgb1 UTSW 16 36928683 missense possibly damaging 0.67
R5592:Golgb1 UTSW 16 36925763 missense probably benign 0.02
R5740:Golgb1 UTSW 16 36919000 missense probably damaging 0.99
R5862:Golgb1 UTSW 16 36926091 splice site silent
R5928:Golgb1 UTSW 16 36911987 missense probably damaging 1.00
R6009:Golgb1 UTSW 16 36914959 missense probably damaging 1.00
R6062:Golgb1 UTSW 16 36914671 missense possibly damaging 0.89
R6102:Golgb1 UTSW 16 36912865 missense probably damaging 1.00
R6198:Golgb1 UTSW 16 36893395 missense probably damaging 1.00
R6253:Golgb1 UTSW 16 36915622 missense possibly damaging 0.77
R6254:Golgb1 UTSW 16 36913978 missense probably damaging 0.99
R6321:Golgb1 UTSW 16 36918197 nonsense probably null
R6700:Golgb1 UTSW 16 36875584 intron probably benign
R6870:Golgb1 UTSW 16 36918203 missense probably damaging 1.00
R6882:Golgb1 UTSW 16 36913990 missense probably benign
R6944:Golgb1 UTSW 16 36912113 missense probably benign
V1662:Golgb1 UTSW 16 36898542 missense probably benign 0.00
X0067:Golgb1 UTSW 16 36914303 nonsense probably null
Z1088:Golgb1 UTSW 16 36919742 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTCCCATAGCAACGCCCTG -3'
(R):5'- TTCAATCGCCCTGAGGCTCGTC -3'

Sequencing Primer
(F):5'- CTTGGGTTACCGAGCTGAC -3'
(R):5'- AACAGCAGGATCATTCGTGG -3'
Posted On2013-04-24