Incidental Mutation 'R4209:Dchs1'
ID319069
Institutional Source Beutler Lab
Gene Symbol Dchs1
Ensembl Gene ENSMUSG00000036862
Gene Namedachsous cadherin related 1
Synonyms3110041P15Rik, C130033F22Rik
MMRRC Submission 041038-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4209 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105752990-105787654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105766190 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 626 (D626E)
Ref Sequence ENSEMBL: ENSMUSP00000077574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078482]
Predicted Effect probably damaging
Transcript: ENSMUST00000078482
AA Change: D626E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: D626E

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CA 58 135 5.2e-11 SMART
CA 159 247 6.1e-17 SMART
CA 271 354 2.6e-30 SMART
CA 382 464 7.8e-26 SMART
CA 489 570 1.2e-34 SMART
CA 594 677 1.9e-27 SMART
CA 701 782 5.3e-11 SMART
CA 806 886 1e-12 SMART
CA 910 990 3.3e-14 SMART
CA 1016 1097 3.6e-18 SMART
CA 1121 1203 3.1e-34 SMART
CA 1233 1307 8.8e-16 SMART
low complexity region 1323 1335 N/A INTRINSIC
CA 1344 1427 9.9e-9 SMART
CA 1451 1537 1.5e-23 SMART
CA 1560 1640 7.2e-32 SMART
CA 1664 1742 1.8e-31 SMART
CA 1765 1846 7.8e-30 SMART
CA 1870 1951 3.7e-26 SMART
low complexity region 1957 1965 N/A INTRINSIC
CA 1979 2059 1.1e-6 SMART
CA 2083 2162 2.7e-18 SMART
CA 2186 2268 2.2e-26 SMART
CA 2291 2367 1e-18 SMART
CA 2391 2473 1.8e-23 SMART
CA 2497 2593 3.5e-21 SMART
CA 2617 2697 1.2e-25 SMART
CA 2721 2804 1.9e-18 SMART
CA 2828 2919 3e-3 SMART
transmembrane domain 2932 2954 N/A INTRINSIC
low complexity region 3001 3017 N/A INTRINSIC
low complexity region 3046 3055 N/A INTRINSIC
low complexity region 3088 3097 N/A INTRINSIC
low complexity region 3185 3196 N/A INTRINSIC
low complexity region 3237 3259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154659
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak G A 19: 9,002,600 G416D probably damaging Het
Ap3b2 C A 7: 81,477,136 A289S probably benign Het
Arhgap23 C A 11: 97,454,496 T657K probably damaging Het
Bcl9 A G 3: 97,209,953 L475P probably damaging Het
Bean1 T A 8: 104,213,934 M1K probably null Het
Cand1 T A 10: 119,211,558 I676F probably benign Het
Casp3 G T 8: 46,635,388 D107Y probably damaging Het
Cops4 T A 5: 100,547,486 probably benign Het
Dpysl2 T C 14: 66,815,477 S308G probably damaging Het
Fezf1 T C 6: 23,246,617 K323E probably damaging Het
Gm10272 T C 10: 77,706,831 V69A possibly damaging Het
Gm8298 A T 3: 59,877,156 Y350F probably damaging Het
Gtf2f1 A G 17: 57,011,003 V11A probably benign Het
Hnf4a T C 2: 163,568,889 S378P probably benign Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Irf8 T A 8: 120,753,469 Y149N probably damaging Het
Kel C T 6: 41,698,425 W297* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Mycl G T 4: 122,999,922 V172L possibly damaging Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Ppp2r2a A G 14: 67,028,879 L111S probably damaging Het
Prdm2 T C 4: 143,134,437 D761G probably damaging Het
Sec11a A T 7: 80,935,042 I49N probably damaging Het
Sesn3 T C 9: 14,306,209 I30T probably benign Het
Slc22a21 A G 11: 53,956,055 S331P probably benign Het
Slc38a3 T G 9: 107,655,348 S358R possibly damaging Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Spns2 T C 11: 72,454,186 D492G probably benign Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tdp1 C A 12: 99,898,329 A243E probably damaging Het
Tex16 T A X: 112,120,943 D1046E probably benign Het
Tmem120a T C 5: 135,735,705 N340S probably benign Het
Tnik A T 3: 28,359,065 probably benign Het
Trim36 A G 18: 46,196,124 L71P probably benign Het
Tube1 A G 10: 39,144,934 probably null Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Veph1 A T 3: 66,244,546 L154Q probably damaging Het
Vmn1r113 T C 7: 20,787,610 V109A probably benign Het
Vmn1r152 A T 7: 22,523,579 T205S possibly damaging Het
Wdsub1 G A 2: 59,876,805 P28S probably damaging Het
Ybx2 G T 11: 69,935,941 probably benign Het
Zfyve1 A T 12: 83,575,135 V162E probably damaging Het
Other mutations in Dchs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Dchs1 APN 7 105758743 missense probably damaging 1.00
IGL00422:Dchs1 APN 7 105758029 missense possibly damaging 0.88
IGL00427:Dchs1 APN 7 105758424 missense probably damaging 0.98
IGL00469:Dchs1 APN 7 105755261 missense probably damaging 1.00
IGL00470:Dchs1 APN 7 105758207 missense probably damaging 1.00
IGL00534:Dchs1 APN 7 105757943 missense probably benign
IGL01292:Dchs1 APN 7 105760891 missense probably damaging 0.98
IGL01380:Dchs1 APN 7 105762211 missense probably damaging 1.00
IGL01396:Dchs1 APN 7 105772283 missense probably damaging 1.00
IGL01448:Dchs1 APN 7 105771927 missense probably damaging 0.98
IGL01759:Dchs1 APN 7 105755302 missense probably benign 0.00
IGL01829:Dchs1 APN 7 105755397 missense probably damaging 0.99
IGL01946:Dchs1 APN 7 105759105 missense probably damaging 1.00
IGL01955:Dchs1 APN 7 105757591 missense probably benign 0.00
IGL02012:Dchs1 APN 7 105764297 missense probably damaging 0.98
IGL02222:Dchs1 APN 7 105764887 missense probably damaging 1.00
IGL02261:Dchs1 APN 7 105772569 missense probably damaging 1.00
IGL02365:Dchs1 APN 7 105755188 missense probably benign 0.22
IGL02430:Dchs1 APN 7 105771971 missense probably benign 0.34
IGL02500:Dchs1 APN 7 105755806 missense probably benign
IGL02741:Dchs1 APN 7 105757323 missense probably damaging 1.00
IGL02890:Dchs1 APN 7 105756491 missense probably damaging 1.00
IGL03213:Dchs1 APN 7 105755072 missense probably damaging 1.00
P0026:Dchs1 UTSW 7 105758405 missense probably damaging 0.99
PIT4377001:Dchs1 UTSW 7 105757588 missense probably damaging 1.00
PIT4791001:Dchs1 UTSW 7 105758971 missense probably damaging 1.00
R0013:Dchs1 UTSW 7 105755836 missense possibly damaging 0.90
R0090:Dchs1 UTSW 7 105755932 missense probably benign 0.18
R0091:Dchs1 UTSW 7 105766094 splice site probably benign
R0193:Dchs1 UTSW 7 105764983 missense probably benign 0.40
R0395:Dchs1 UTSW 7 105758538 missense probably damaging 1.00
R0448:Dchs1 UTSW 7 105765927 missense probably benign 0.00
R0480:Dchs1 UTSW 7 105771489 missense probably benign 0.14
R0485:Dchs1 UTSW 7 105772727 missense probably benign 0.00
R0566:Dchs1 UTSW 7 105759195 missense probably benign 0.00
R0571:Dchs1 UTSW 7 105771996 missense probably damaging 1.00
R0573:Dchs1 UTSW 7 105758778 missense probably damaging 0.98
R0577:Dchs1 UTSW 7 105764255 missense possibly damaging 0.78
R0622:Dchs1 UTSW 7 105763449 missense probably damaging 1.00
R0654:Dchs1 UTSW 7 105772349 missense probably damaging 1.00
R0677:Dchs1 UTSW 7 105764984 missense probably damaging 1.00
R1171:Dchs1 UTSW 7 105757714 missense probably benign
R1241:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R1389:Dchs1 UTSW 7 105755571 missense probably benign 0.40
R1427:Dchs1 UTSW 7 105766191 missense probably benign 0.06
R1458:Dchs1 UTSW 7 105755244 missense probably damaging 1.00
R1513:Dchs1 UTSW 7 105772071 nonsense probably null
R1524:Dchs1 UTSW 7 105764525 missense probably damaging 1.00
R1525:Dchs1 UTSW 7 105758931 missense probably damaging 1.00
R1534:Dchs1 UTSW 7 105772040 missense probably damaging 0.98
R1567:Dchs1 UTSW 7 105771861 missense probably benign 0.01
R1577:Dchs1 UTSW 7 105765955 missense probably damaging 1.00
R1603:Dchs1 UTSW 7 105762770 missense probably benign 0.24
R1676:Dchs1 UTSW 7 105754921 missense probably benign 0.40
R1794:Dchs1 UTSW 7 105771720 missense probably benign 0.02
R1826:Dchs1 UTSW 7 105757627 missense probably damaging 1.00
R1892:Dchs1 UTSW 7 105764156 missense probably benign 0.00
R1924:Dchs1 UTSW 7 105772280 missense possibly damaging 0.81
R1932:Dchs1 UTSW 7 105765902 missense probably damaging 1.00
R1962:Dchs1 UTSW 7 105764201 missense probably damaging 1.00
R1985:Dchs1 UTSW 7 105772398 missense possibly damaging 0.72
R1993:Dchs1 UTSW 7 105762548 missense probably benign 0.00
R2007:Dchs1 UTSW 7 105755325 missense probably damaging 1.00
R2316:Dchs1 UTSW 7 105764204 missense possibly damaging 0.71
R2351:Dchs1 UTSW 7 105754094 missense probably benign
R2474:Dchs1 UTSW 7 105755074 missense probably benign 0.37
R2474:Dchs1 UTSW 7 105772838 missense probably damaging 1.00
R3429:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3430:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3737:Dchs1 UTSW 7 105762316 missense possibly damaging 0.88
R3767:Dchs1 UTSW 7 105757085 missense possibly damaging 0.67
R3874:Dchs1 UTSW 7 105761635 missense probably damaging 1.00
R3883:Dchs1 UTSW 7 105762563 missense probably damaging 1.00
R4105:Dchs1 UTSW 7 105765140 missense probably damaging 1.00
R4329:Dchs1 UTSW 7 105753759 missense probably damaging 1.00
R4516:Dchs1 UTSW 7 105754852 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105754765 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105758973 missense probably benign
R4588:Dchs1 UTSW 7 105756041 missense probably benign
R4613:Dchs1 UTSW 7 105772724 missense probably damaging 1.00
R4632:Dchs1 UTSW 7 105754355 missense probably benign 0.02
R4696:Dchs1 UTSW 7 105764627 missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4725:Dchs1 UTSW 7 105765552 missense probably damaging 1.00
R4738:Dchs1 UTSW 7 105758673 missense probably damaging 0.96
R4768:Dchs1 UTSW 7 105771620 missense possibly damaging 0.96
R4784:Dchs1 UTSW 7 105765926 missense probably damaging 1.00
R4864:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4880:Dchs1 UTSW 7 105755730 missense probably benign 0.00
R4909:Dchs1 UTSW 7 105766255 missense probably damaging 1.00
R5102:Dchs1 UTSW 7 105772177 missense probably benign 0.09
R5109:Dchs1 UTSW 7 105765014 missense probably benign
R5126:Dchs1 UTSW 7 105753517 missense probably damaging 1.00
R5149:Dchs1 UTSW 7 105755658 missense probably damaging 0.98
R5330:Dchs1 UTSW 7 105754602 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105772055 missense probably damaging 1.00
R5386:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5622:Dchs1 UTSW 7 105755293 missense probably benign 0.11
R5623:Dchs1 UTSW 7 105772769 missense probably damaging 1.00
R5708:Dchs1 UTSW 7 105772809 missense probably damaging 1.00
R5718:Dchs1 UTSW 7 105755748 missense probably benign 0.01
R5743:Dchs1 UTSW 7 105771596 missense probably benign
R5759:Dchs1 UTSW 7 105764176 missense probably damaging 0.99
R5772:Dchs1 UTSW 7 105773040 missense probably damaging 1.00
R5860:Dchs1 UTSW 7 105772035 missense probably damaging 1.00
R5916:Dchs1 UTSW 7 105759166 missense probably damaging 1.00
R5965:Dchs1 UTSW 7 105755925 missense probably damaging 1.00
R5997:Dchs1 UTSW 7 105754095 missense probably benign 0.08
R6065:Dchs1 UTSW 7 105755421 missense probably damaging 1.00
R6136:Dchs1 UTSW 7 105760925 missense probably benign
R6137:Dchs1 UTSW 7 105765106 missense probably damaging 0.99
R6324:Dchs1 UTSW 7 105764938 missense probably benign 0.05
R6363:Dchs1 UTSW 7 105758472 missense probably benign 0.12
R6466:Dchs1 UTSW 7 105764541 missense probably benign 0.09
R6544:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R6572:Dchs1 UTSW 7 105758806 missense possibly damaging 0.94
R6579:Dchs1 UTSW 7 105762913 missense probably benign 0.17
R6632:Dchs1 UTSW 7 105761878 missense probably damaging 1.00
R6725:Dchs1 UTSW 7 105758793 missense probably damaging 0.99
R6789:Dchs1 UTSW 7 105757003 missense possibly damaging 0.61
R6868:Dchs1 UTSW 7 105763503 missense possibly damaging 0.91
R7058:Dchs1 UTSW 7 105757021 missense probably benign
R7064:Dchs1 UTSW 7 105763185 missense probably damaging 0.99
R7076:Dchs1 UTSW 7 105761871 missense probably benign 0.04
R7191:Dchs1 UTSW 7 105765439 missense possibly damaging 0.89
R7298:Dchs1 UTSW 7 105755131 nonsense probably null
R7380:Dchs1 UTSW 7 105758628 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AGCCATCAGTCAATAGACCTTG -3'
(R):5'- TTGTAACCAGAGCCTCCCAG -3'

Sequencing Primer
(F):5'- GTCAATAGACCTTGTCTAACTTTGG -3'
(R):5'- GAGCCTCCCAGGAACCTAAGTG -3'
Posted On2015-06-10