Incidental Mutation 'R4209:Casp3'
ID319070
Institutional Source Beutler Lab
Gene Symbol Casp3
Ensembl Gene ENSMUSG00000031628
Gene Namecaspase 3
Synonymsmldy, Yama, Caspase-3, Apopain, CPP32, A830040C14Rik, CC3, AC-3
MMRRC Submission 041038-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4209 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location46617291-46639689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 46635388 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 107 (D107Y)
Ref Sequence ENSEMBL: ENSMUSP00000147767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093517] [ENSMUST00000210534] [ENSMUST00000211115]
Predicted Effect probably damaging
Transcript: ENSMUST00000093517
AA Change: D107Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091238
Gene: ENSMUSG00000031628
AA Change: D107Y

DomainStartEndE-ValueType
CASc 36 277 9.95e-143 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209668
Predicted Effect probably benign
Transcript: ENSMUST00000210534
Predicted Effect probably damaging
Transcript: ENSMUST00000211115
AA Change: D107Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: This gene encodes a protein that belongs to a highly conserved family of cysteinyl aspartate-specific proteases that function as essential regulators of programmed cell death through apoptosis. Members of this family contain an N-terminal pro-domain and require cleavage at specific aspartate residues to become mature. The protein encoded by this gene belongs to a subgroup of cysteinyl aspartate-specific proteases that are activated by initiator caspases and that perform the proteolytic cleavage of apoptotic target proteins. Mice defective for this gene exhibit a variety of phenotypes including reduced neuronal apoptosis resulting in hyperplasias, hearing loss, attenuated osteogenic differentiation of bone marrow stromal stem cells, and pre- and post-natal lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Some homozygous animals show defects in brain development by embryonic day 12, reduced neuronal apoptosis causing hyperplasias, and pre- and postnatal lethality. Other homozygous animals exhibit only hearing loss, inner ear defects and degeneration of spiral ganglion neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak G A 19: 9,002,600 G416D probably damaging Het
Ap3b2 C A 7: 81,477,136 A289S probably benign Het
Arhgap23 C A 11: 97,454,496 T657K probably damaging Het
Bcl9 A G 3: 97,209,953 L475P probably damaging Het
Bean1 T A 8: 104,213,934 M1K probably null Het
Cand1 T A 10: 119,211,558 I676F probably benign Het
Cops4 T A 5: 100,547,486 probably benign Het
Dchs1 A T 7: 105,766,190 D626E probably damaging Het
Dpysl2 T C 14: 66,815,477 S308G probably damaging Het
Fezf1 T C 6: 23,246,617 K323E probably damaging Het
Gm10272 T C 10: 77,706,831 V69A possibly damaging Het
Gm8298 A T 3: 59,877,156 Y350F probably damaging Het
Gtf2f1 A G 17: 57,011,003 V11A probably benign Het
Hnf4a T C 2: 163,568,889 S378P probably benign Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Irf8 T A 8: 120,753,469 Y149N probably damaging Het
Kel C T 6: 41,698,425 W297* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Mycl G T 4: 122,999,922 V172L possibly damaging Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Ppp2r2a A G 14: 67,028,879 L111S probably damaging Het
Prdm2 T C 4: 143,134,437 D761G probably damaging Het
Sec11a A T 7: 80,935,042 I49N probably damaging Het
Sesn3 T C 9: 14,306,209 I30T probably benign Het
Slc22a21 A G 11: 53,956,055 S331P probably benign Het
Slc38a3 T G 9: 107,655,348 S358R possibly damaging Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Spns2 T C 11: 72,454,186 D492G probably benign Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tdp1 C A 12: 99,898,329 A243E probably damaging Het
Tex16 T A X: 112,120,943 D1046E probably benign Het
Tmem120a T C 5: 135,735,705 N340S probably benign Het
Tnik A T 3: 28,359,065 probably benign Het
Trim36 A G 18: 46,196,124 L71P probably benign Het
Tube1 A G 10: 39,144,934 probably null Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Veph1 A T 3: 66,244,546 L154Q probably damaging Het
Vmn1r113 T C 7: 20,787,610 V109A probably benign Het
Vmn1r152 A T 7: 22,523,579 T205S possibly damaging Het
Wdsub1 G A 2: 59,876,805 P28S probably damaging Het
Ybx2 G T 11: 69,935,941 probably benign Het
Zfyve1 A T 12: 83,575,135 V162E probably damaging Het
Other mutations in Casp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Casp3 APN 8 46629741 utr 5 prime probably benign
warner UTSW 8 46635388 missense probably damaging 1.00
R0601:Casp3 UTSW 8 46636227 missense probably benign 0.00
R1541:Casp3 UTSW 8 46634334 missense probably benign 0.02
R1648:Casp3 UTSW 8 46638074 missense probably benign
R2046:Casp3 UTSW 8 46629726 splice site probably benign
R2159:Casp3 UTSW 8 46634288 missense probably damaging 1.00
R2176:Casp3 UTSW 8 46629756 missense probably damaging 1.00
R2251:Casp3 UTSW 8 46637955 missense probably damaging 0.98
R2252:Casp3 UTSW 8 46637955 missense probably damaging 0.98
R2253:Casp3 UTSW 8 46637955 missense probably damaging 0.98
R4095:Casp3 UTSW 8 46634216 missense probably damaging 1.00
R4211:Casp3 UTSW 8 46635388 missense probably damaging 1.00
R4868:Casp3 UTSW 8 46634279 missense probably benign 0.01
R5713:Casp3 UTSW 8 46636314 missense probably damaging 1.00
R6847:Casp3 UTSW 8 46636266 missense probably benign 0.00
R6957:Casp3 UTSW 8 46634273 missense probably damaging 1.00
R7196:Casp3 UTSW 8 46635463 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCTGTGTTAGACTTGGATGCTC -3'
(R):5'- TGCCCTACCTGAATGATGAAG -3'

Sequencing Primer
(F):5'- TGTCATGGTATAACAGTAACCCCAG -3'
(R):5'- CCCTACCTGAATGATGAAGAGTTTCG -3'
Posted On2015-06-10