Incidental Mutation 'R4210:Adgb'
ID319136
Institutional Source Beutler Lab
Gene Symbol Adgb
Ensembl Gene ENSMUSG00000050994
Gene Nameandroglobin
Synonyms9130014G24Rik
MMRRC Submission 041039-MU
Accession Numbers

MGI:3605549

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4210 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location10335703-10472326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10407465 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 166 (I166V)
Ref Sequence ENSEMBL: ENSMUSP00000045452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045328] [ENSMUST00000132573] [ENSMUST00000148816] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]
Predicted Effect probably benign
Transcript: ENSMUST00000045328
AA Change: I166V

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000045452
Gene: ENSMUSG00000050994
AA Change: I166V

DomainStartEndE-ValueType
Blast:CysPc 11 257 1e-165 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132573
AA Change: I564V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000120422
Gene: ENSMUSG00000050994
AA Change: I564V

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148816
SMART Domains Protein: ENSMUSP00000133652
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
Blast:CysPc 1 41 1e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172530
AA Change: I564V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: I564V

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
IQ 904 926 6.41e0 SMART
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1318 1335 N/A INTRINSIC
coiled coil region 1534 1559 N/A INTRINSIC
low complexity region 1616 1633 N/A INTRINSIC
low complexity region 1649 1657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179956
AA Change: I564V

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: I564V

DomainStartEndE-ValueType
CysPc 56 657 5.36e-2 SMART
IQ 906 928 6.41e0 SMART
low complexity region 1181 1192 N/A INTRINSIC
low complexity region 1321 1338 N/A INTRINSIC
coiled coil region 1537 1562 N/A INTRINSIC
low complexity region 1619 1636 N/A INTRINSIC
low complexity region 1652 1660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208717
AA Change: I540V

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C T 2: 68,659,878 probably benign Het
Abl1 T C 2: 31,801,696 Y1076H probably damaging Het
Adamts7 C T 9: 90,194,010 T1265I possibly damaging Het
Axin2 T A 11: 108,942,576 I529N possibly damaging Het
Bbof1 T C 12: 84,409,183 M1T probably null Het
BC051142 G T 17: 34,460,283 probably benign Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cmpk2 G T 12: 26,469,571 A74S probably benign Het
Colgalt1 G A 8: 71,622,706 V419I probably benign Het
Crybg3 A G 16: 59,544,051 S2403P probably damaging Het
D930048N14Rik G A 11: 51,654,805 probably benign Het
Dnah7b T A 1: 46,137,418 C733S possibly damaging Het
Drc1 G A 5: 30,347,146 V211M possibly damaging Het
Ephx2 T C 14: 66,084,944 T525A probably damaging Het
Eya4 A G 10: 23,226,800 probably null Het
Foxc1 T C 13: 31,807,707 F167S probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gm6370 C A 5: 146,493,924 F306L possibly damaging Het
Hmgcr A G 13: 96,660,221 V187A probably damaging Het
Igkv9-129 T A 6: 67,840,258 S114R possibly damaging Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Ikzf3 T C 11: 98,490,487 Y89C probably benign Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Iqsec3 T C 6: 121,413,040 probably benign Het
Itga3 C A 11: 95,062,623 V298L probably benign Het
Kel C T 6: 41,698,425 W297* probably null Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lbh T A 17: 72,921,183 probably null Het
Lrba G A 3: 86,360,126 G1708S probably damaging Het
Lrig2 C T 3: 104,467,304 V154I probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mast4 A T 13: 102,739,205 F1318L probably damaging Het
Ncam2 T C 16: 81,527,103 V545A probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Olfr263 A T 13: 21,133,437 I221L possibly damaging Het
Olfr430 G A 1: 174,070,008 A237T probably damaging Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Pdlim4 T G 11: 54,055,918 D181A possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Pik3r4 G A 9: 105,650,758 A437T possibly damaging Het
Proser3 G A 7: 30,546,100 probably benign Het
Rax T A 18: 65,935,081 N318Y unknown Het
Rnf152 A G 1: 105,284,352 V160A probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Sidt2 T C 9: 45,942,775 T652A probably benign Het
Slc12a7 A G 13: 73,814,843 Y1054C probably damaging Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Sspo C A 6: 48,464,901 H1948Q probably benign Het
Stap2 G T 17: 55,997,827 Y318* probably null Het
Sytl1 T C 4: 133,253,565 D421G probably damaging Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tenm3 C T 8: 48,349,404 G374D probably damaging Het
Terf2 A G 8: 107,079,448 S291P probably damaging Het
Tex16 T A X: 112,120,943 D1046E probably benign Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Tnxb T C 17: 34,710,977 I2895T possibly damaging Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Uxs1 T A 1: 43,750,238 H419L possibly damaging Het
Vmn1r152 A T 7: 22,523,579 T205S possibly damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Zc3h14 A G 12: 98,785,399 H199R probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfp976 A G 7: 42,616,325 F12S probably damaging Het
Other mutations in Adgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Adgb APN 10 10406099 missense possibly damaging 0.87
IGL01083:Adgb APN 10 10407554 missense possibly damaging 0.50
IGL03064:Adgb APN 10 10400572 missense probably benign 0.02
R0080:Adgb UTSW 10 10377839 splice site probably benign
R0084:Adgb UTSW 10 10396344 missense possibly damaging 0.74
R0112:Adgb UTSW 10 10407158 splice site probably benign
R0348:Adgb UTSW 10 10357879 missense probably benign
R0415:Adgb UTSW 10 10431067 splice site probably null
R0633:Adgb UTSW 10 10391729 missense probably benign 0.36
R1052:Adgb UTSW 10 10442613 missense probably benign 0.29
R1248:Adgb UTSW 10 10395310 missense probably damaging 0.98
R1278:Adgb UTSW 10 10382828 missense probably damaging 1.00
R1568:Adgb UTSW 10 10442665 nonsense probably null
R1647:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1648:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1663:Adgb UTSW 10 10339675 missense possibly damaging 0.86
R1688:Adgb UTSW 10 10350317 nonsense probably null
R1758:Adgb UTSW 10 10426605 missense probably damaging 1.00
R1772:Adgb UTSW 10 10382721 splice site probably benign
R1850:Adgb UTSW 10 10442502 missense probably damaging 1.00
R1959:Adgb UTSW 10 10395249 missense probably benign 0.02
R1980:Adgb UTSW 10 10433498 missense probably benign
R2179:Adgb UTSW 10 10395274 missense possibly damaging 0.94
R2229:Adgb UTSW 10 10436051 missense probably damaging 1.00
R2283:Adgb UTSW 10 10377891 missense probably damaging 0.99
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2875:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2876:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2920:Adgb UTSW 10 10390243 missense probably damaging 1.00
R2931:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R3722:Adgb UTSW 10 10340510 missense probably benign 0.32
R3846:Adgb UTSW 10 10382721 splice site probably benign
R3877:Adgb UTSW 10 10442483 critical splice donor site probably null
R4211:Adgb UTSW 10 10407465 missense probably benign 0.06
R4333:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R4448:Adgb UTSW 10 10390825 missense probably benign 0.32
R4470:Adgb UTSW 10 10398951 missense probably benign 0.02
R4624:Adgb UTSW 10 10403004 missense probably benign 0.00
R4656:Adgb UTSW 10 10405306 missense probably damaging 0.99
R4676:Adgb UTSW 10 10426710 missense probably damaging 1.00
R4792:Adgb UTSW 10 10398903 missense probably damaging 0.96
R4795:Adgb UTSW 10 10357872 missense probably benign 0.01
R4858:Adgb UTSW 10 10349577 missense probably damaging 1.00
R4985:Adgb UTSW 10 10400632 missense possibly damaging 0.69
R5057:Adgb UTSW 10 10357978 missense probably benign 0.11
R5157:Adgb UTSW 10 10398966 missense probably damaging 1.00
R5209:Adgb UTSW 10 10398937 missense possibly damaging 0.71
R5339:Adgb UTSW 10 10442606 missense probably damaging 1.00
R5376:Adgb UTSW 10 10346563 missense probably benign 0.09
R5426:Adgb UTSW 10 10350260 missense probably benign 0.14
R5516:Adgb UTSW 10 10431157 missense probably damaging 1.00
R5554:Adgb UTSW 10 10340473 missense probably damaging 0.98
R5678:Adgb UTSW 10 10431326 missense possibly damaging 0.83
R5707:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5708:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5891:Adgb UTSW 10 10377847 nonsense probably null
R5928:Adgb UTSW 10 10378787 missense probably damaging 1.00
R6005:Adgb UTSW 10 10395352 missense probably damaging 1.00
R6017:Adgb UTSW 10 10450036 missense probably damaging 1.00
R6049:Adgb UTSW 10 10378026 missense probably damaging 1.00
R6118:Adgb UTSW 10 10431291 missense probably damaging 1.00
R6175:Adgb UTSW 10 10398943 missense possibly damaging 0.94
R6186:Adgb UTSW 10 10422758 missense probably damaging 1.00
R6234:Adgb UTSW 10 10353080 intron probably null
R6383:Adgb UTSW 10 10450028 missense probably damaging 1.00
R6522:Adgb UTSW 10 10377892 nonsense probably null
R6639:Adgb UTSW 10 10435956 missense possibly damaging 0.51
R6697:Adgb UTSW 10 10406126 nonsense probably null
R6742:Adgb UTSW 10 10411849 missense probably damaging 1.00
R6745:Adgb UTSW 10 10390197 missense probably damaging 1.00
R6850:Adgb UTSW 10 10394574 missense probably benign 0.39
X0003:Adgb UTSW 10 10394630 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TGCCACTTTCTAAATGGCCACAG -3'
(R):5'- AGCAGAATCCACCCTTTTATTGTTG -3'

Sequencing Primer
(F):5'- TGGCCACAGATACATAAGGTTC -3'
(R):5'- GAATCCACCCTTTTATTGTTGTTGAC -3'
Posted On2015-06-10