Incidental Mutation 'R4211:Ecel1'
ID319169
Institutional Source Beutler Lab
Gene Symbol Ecel1
Ensembl Gene ENSMUSG00000026247
Gene Nameendothelin converting enzyme-like 1
SynonymsXCE, DINE
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4211 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location87147655-87156521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87152150 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 414 (S414P)
Ref Sequence ENSEMBL: ENSMUSP00000125096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027463] [ENSMUST00000160810] [ENSMUST00000161002]
Predicted Effect probably damaging
Transcript: ENSMUST00000027463
AA Change: S414P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027463
Gene: ENSMUSG00000026247
AA Change: S414P

DomainStartEndE-ValueType
low complexity region 32 54 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
Pfam:Peptidase_M13_N 124 513 6.4e-112 PFAM
Pfam:Peptidase_M13 571 774 5.2e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159662
Predicted Effect probably damaging
Transcript: ENSMUST00000160810
AA Change: S414P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125557
Gene: ENSMUSG00000026247
AA Change: S414P

DomainStartEndE-ValueType
low complexity region 32 54 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
Pfam:Peptidase_M13_N 124 513 1.2e-98 PFAM
Pfam:Peptidase_M13 571 774 2.3e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161002
AA Change: S414P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125096
Gene: ENSMUSG00000026247
AA Change: S414P

DomainStartEndE-ValueType
low complexity region 32 54 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
Pfam:Peptidase_M13_N 124 513 6.4e-112 PFAM
Pfam:Peptidase_M13 571 774 5.2e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162015
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M13 family of endopeptidases. Members of this family are zinc-containing type II integral-membrane proteins that are important regulators of neuropeptide and peptide hormone activity. Mutations in this gene are associated with autosomal recessive distal arthrogryposis, type 5D. This gene has multiple pseudogenes on chromosome 2. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Targeted mutations of this gene result in respiratory distress causing neonatal lethality due to reduced diaphram innervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T G 5: 90,564,237 V63G probably damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Anapc5 T C 5: 122,817,905 E154G probably benign Het
Anpep A T 7: 79,840,996 Y257* probably null Het
Atp8b1 A T 18: 64,553,047 D688E probably damaging Het
Bub1b C A 2: 118,630,978 H670Q possibly damaging Het
Casp3 G T 8: 46,635,388 D107Y probably damaging Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cr2 A C 1: 195,156,328 L671R probably damaging Het
Cttnbp2 A G 6: 18,427,543 V713A probably damaging Het
Cyp4a31 T C 4: 115,565,013 F65L probably benign Het
Dpysl2 T C 14: 66,815,477 S308G probably damaging Het
Dusp22 A T 13: 30,708,743 I168F probably benign Het
Fat2 A G 11: 55,283,984 F1968L probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gatsl2 T C 5: 134,125,944 probably null Het
H2-DMb1 T A 17: 34,155,573 F66I possibly damaging Het
Hgf T C 5: 16,614,993 V574A probably damaging Het
Hoxa7 A T 6: 52,216,625 Y137* probably null Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Kmt2d A G 15: 98,840,189 probably benign Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lepr C T 4: 101,733,414 A63V probably benign Het
Lmx1a G T 1: 167,832,859 V238L probably damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mcmbp T C 7: 128,716,005 E172G possibly damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Nek8 C A 11: 78,170,483 V379L probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Pard6b C T 2: 168,099,023 A310V probably benign Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Plch1 C A 3: 63,711,219 D675Y probably damaging Het
Plk2 A G 13: 110,396,337 H144R probably damaging Het
Rax T A 18: 65,935,081 N318Y unknown Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Smarcd2 T A 11: 106,266,905 K138* probably null Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tango6 A G 8: 106,689,224 I226V probably benign Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tdp1 C A 12: 99,898,329 A243E probably damaging Het
Tfpt A G 7: 3,620,387 Y240H probably damaging Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Top3b A G 16: 16,882,532 probably null Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfyve1 A T 12: 83,575,135 V162E probably damaging Het
Other mutations in Ecel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Ecel1 APN 1 87153193 missense possibly damaging 0.84
IGL01431:Ecel1 APN 1 87151504 missense probably damaging 0.99
IGL01992:Ecel1 APN 1 87149855 splice site probably benign
IGL02040:Ecel1 APN 1 87154923 missense probably benign 0.32
IGL02230:Ecel1 APN 1 87152194 missense probably damaging 1.00
IGL02801:Ecel1 APN 1 87152003 missense probably damaging 1.00
Capulin UTSW 1 87153301 missense probably damaging 0.99
R0139:Ecel1 UTSW 1 87154526 missense possibly damaging 0.95
R1723:Ecel1 UTSW 1 87154421 missense probably benign 0.37
R2118:Ecel1 UTSW 1 87148275 missense probably damaging 1.00
R2119:Ecel1 UTSW 1 87148275 missense probably damaging 1.00
R2120:Ecel1 UTSW 1 87148275 missense probably damaging 1.00
R2122:Ecel1 UTSW 1 87148275 missense probably damaging 1.00
R3815:Ecel1 UTSW 1 87152900 missense probably damaging 0.97
R3836:Ecel1 UTSW 1 87150656 missense probably damaging 1.00
R4685:Ecel1 UTSW 1 87152946 splice site probably null
R4841:Ecel1 UTSW 1 87153301 missense probably damaging 0.99
R4842:Ecel1 UTSW 1 87153301 missense probably damaging 0.99
R4888:Ecel1 UTSW 1 87148727 splice site probably benign
R4976:Ecel1 UTSW 1 87151139 missense probably benign 0.17
R5032:Ecel1 UTSW 1 87154253 missense probably damaging 0.97
R5119:Ecel1 UTSW 1 87151139 missense probably benign 0.17
R5393:Ecel1 UTSW 1 87152876 missense possibly damaging 0.95
R5798:Ecel1 UTSW 1 87151483 missense probably damaging 1.00
R5862:Ecel1 UTSW 1 87149596 missense probably benign 0.19
R5874:Ecel1 UTSW 1 87148009 missense probably benign 0.24
R6341:Ecel1 UTSW 1 87150471 splice site probably null
R6351:Ecel1 UTSW 1 87149509 missense possibly damaging 0.56
R6534:Ecel1 UTSW 1 87154842 missense probably benign 0.13
R7405:Ecel1 UTSW 1 87153516 critical splice donor site probably null
R7422:Ecel1 UTSW 1 87149612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTGGCTTTACTGGCAGC -3'
(R):5'- TGGGACAGTTCAAATTGATTTCTGC -3'

Sequencing Primer
(F):5'- CAGCTGAGAAGTGTTCATGTAC -3'
(R):5'- CTCCTTCTTAGTGGGGCAGG -3'
Posted On2015-06-10