Incidental Mutation 'R4211:Lmx1a'
ID319172
Institutional Source Beutler Lab
Gene Symbol Lmx1a
Ensembl Gene ENSMUSG00000026686
Gene NameLIM homeobox transcription factor 1 alpha
Synonymsshaker short-tail, Lmx1.1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.864) question?
Stock #R4211 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location167689237-167848741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 167832859 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 238 (V238L)
Ref Sequence ENSEMBL: ENSMUSP00000107008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028003] [ENSMUST00000111377]
Predicted Effect probably damaging
Transcript: ENSMUST00000028003
AA Change: V238L

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028003
Gene: ENSMUSG00000026686
AA Change: V238L

DomainStartEndE-ValueType
LIM 34 85 2.87e-15 SMART
LIM 93 147 3.39e-17 SMART
HOX 195 257 2.62e-21 SMART
low complexity region 337 350 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111377
AA Change: V238L

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107008
Gene: ENSMUSG00000026686
AA Change: V238L

DomainStartEndE-ValueType
LIM 34 85 2.87e-15 SMART
LIM 93 147 3.39e-17 SMART
HOX 195 257 2.62e-21 SMART
low complexity region 337 350 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeodomain and LIM-domain containing protein. The encoded protein is a transcription factor that acts as a positive regulator of insulin gene transcription. This gene also plays a role in the development of dopamine producing neurons during embryogenesis. Mutations in this gene are associated with an increased risk of developing Parkinson's disease. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mutations in the dreher locus produce neurological and skeletal abnormalities, inner ear defects, and belly spotting. Deafness and hypoplasia of Mullerian duct derivatives are also reported for some alleles. Homozygous null mice have fewer dopaminergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T G 5: 90,564,237 V63G probably damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Anapc5 T C 5: 122,817,905 E154G probably benign Het
Anpep A T 7: 79,840,996 Y257* probably null Het
Atp8b1 A T 18: 64,553,047 D688E probably damaging Het
Bub1b C A 2: 118,630,978 H670Q possibly damaging Het
Casp3 G T 8: 46,635,388 D107Y probably damaging Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cr2 A C 1: 195,156,328 L671R probably damaging Het
Cttnbp2 A G 6: 18,427,543 V713A probably damaging Het
Cyp4a31 T C 4: 115,565,013 F65L probably benign Het
Dpysl2 T C 14: 66,815,477 S308G probably damaging Het
Dusp22 A T 13: 30,708,743 I168F probably benign Het
Ecel1 A G 1: 87,152,150 S414P probably damaging Het
Fat2 A G 11: 55,283,984 F1968L probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gatsl2 T C 5: 134,125,944 probably null Het
H2-DMb1 T A 17: 34,155,573 F66I possibly damaging Het
Hgf T C 5: 16,614,993 V574A probably damaging Het
Hoxa7 A T 6: 52,216,625 Y137* probably null Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Kmt2d A G 15: 98,840,189 probably benign Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lepr C T 4: 101,733,414 A63V probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mcmbp T C 7: 128,716,005 E172G possibly damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Nek8 C A 11: 78,170,483 V379L probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Pard6b C T 2: 168,099,023 A310V probably benign Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Plch1 C A 3: 63,711,219 D675Y probably damaging Het
Plk2 A G 13: 110,396,337 H144R probably damaging Het
Rax T A 18: 65,935,081 N318Y unknown Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Smarcd2 T A 11: 106,266,905 K138* probably null Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tango6 A G 8: 106,689,224 I226V probably benign Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tdp1 C A 12: 99,898,329 A243E probably damaging Het
Tfpt A G 7: 3,620,387 Y240H probably damaging Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Top3b A G 16: 16,882,532 probably null Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfyve1 A T 12: 83,575,135 V162E probably damaging Het
Other mutations in Lmx1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02624:Lmx1a APN 1 167844623 splice site probably benign
IGL02629:Lmx1a APN 1 167844623 splice site probably benign
IGL02637:Lmx1a APN 1 167844623 splice site probably benign
IGL02642:Lmx1a APN 1 167844623 splice site probably benign
IGL02811:Lmx1a APN 1 167791374 missense probably benign 0.06
scooby UTSW 1 167830687 missense possibly damaging 0.47
R0320:Lmx1a UTSW 1 167791404 nonsense probably null
R1217:Lmx1a UTSW 1 167791399 missense probably damaging 1.00
R2897:Lmx1a UTSW 1 167830540 splice site probably benign
R4976:Lmx1a UTSW 1 167791554 missense possibly damaging 0.73
R5125:Lmx1a UTSW 1 167830687 missense possibly damaging 0.47
R6858:Lmx1a UTSW 1 167832881 missense probably damaging 1.00
R7099:Lmx1a UTSW 1 167830546 missense probably damaging 1.00
R7177:Lmx1a UTSW 1 167846678 missense probably benign
R7380:Lmx1a UTSW 1 167692040 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGAATGTGACCTATGCCCC -3'
(R):5'- ACACAGACACTTCGCTTCTC -3'

Sequencing Primer
(F):5'- GTGACCTATGCCCCCACCC -3'
(R):5'- CGCTGTGGCTGAAATAATTGC -3'
Posted On2015-06-10