Incidental Mutation 'R4211:Tmod4'
ID319179
Institutional Source Beutler Lab
Gene Symbol Tmod4
Ensembl Gene ENSMUSG00000005628
Gene Nametropomodulin 4
SynonymsMTMOD, skeletal tropomodulin, Sk-Tmod
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R4211 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95124476-95129209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95127829 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 215 (D215G)
Ref Sequence ENSEMBL: ENSMUSP00000102846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005769] [ENSMUST00000009102] [ENSMUST00000107227] [ENSMUST00000131597] [ENSMUST00000172572] [ENSMUST00000173462]
Predicted Effect probably benign
Transcript: ENSMUST00000005769
AA Change: D215G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000005769
Gene: ENSMUSG00000005628
AA Change: D215G

DomainStartEndE-ValueType
Pfam:Tropomodulin 4 143 2.7e-62 PFAM
PDB:1IO0|A 160 343 6e-77 PDB
SCOP:d1a4ya_ 184 289 4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000009102
SMART Domains Protein: ENSMUSP00000009102
Gene: ENSMUSG00000008958

DomainStartEndE-ValueType
Pfam:YL1 5 216 5.1e-58 PFAM
low complexity region 247 264 N/A INTRINSIC
YL1_C 294 323 5.99e-9 SMART
low complexity region 335 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107227
AA Change: D215G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102846
Gene: ENSMUSG00000005628
AA Change: D215G

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 144 4.4e-72 PFAM
PDB:1IO0|A 160 343 6e-77 PDB
SCOP:d1a4ya_ 184 289 4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130545
Predicted Effect probably benign
Transcript: ENSMUST00000131597
SMART Domains Protein: ENSMUSP00000116341
Gene: ENSMUSG00000005628

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 144 1.5e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149898
Predicted Effect probably benign
Transcript: ENSMUST00000172572
SMART Domains Protein: ENSMUSP00000134337
Gene: ENSMUSG00000092607

DomainStartEndE-ValueType
Pfam:zf-SCNM1 44 70 7.6e-19 PFAM
low complexity region 133 148 N/A INTRINSIC
low complexity region 172 179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173462
SMART Domains Protein: ENSMUSP00000133769
Gene: ENSMUSG00000092607

DomainStartEndE-ValueType
Blast:ZnF_C2H2 42 68 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174508
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196728
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199730
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and exhibit no overt myopathy, with normal thin filament lengths, myofibril organization, and skeletal muscle contractile function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T G 5: 90,564,237 V63G probably damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Anapc5 T C 5: 122,817,905 E154G probably benign Het
Anpep A T 7: 79,840,996 Y257* probably null Het
Atp8b1 A T 18: 64,553,047 D688E probably damaging Het
Bub1b C A 2: 118,630,978 H670Q possibly damaging Het
Casp3 G T 8: 46,635,388 D107Y probably damaging Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cr2 A C 1: 195,156,328 L671R probably damaging Het
Cttnbp2 A G 6: 18,427,543 V713A probably damaging Het
Cyp4a31 T C 4: 115,565,013 F65L probably benign Het
Dpysl2 T C 14: 66,815,477 S308G probably damaging Het
Dusp22 A T 13: 30,708,743 I168F probably benign Het
Ecel1 A G 1: 87,152,150 S414P probably damaging Het
Fat2 A G 11: 55,283,984 F1968L probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gatsl2 T C 5: 134,125,944 probably null Het
H2-DMb1 T A 17: 34,155,573 F66I possibly damaging Het
Hgf T C 5: 16,614,993 V574A probably damaging Het
Hoxa7 A T 6: 52,216,625 Y137* probably null Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Kmt2d A G 15: 98,840,189 probably benign Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lepr C T 4: 101,733,414 A63V probably benign Het
Lmx1a G T 1: 167,832,859 V238L probably damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mcmbp T C 7: 128,716,005 E172G possibly damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Nek8 C A 11: 78,170,483 V379L probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Pard6b C T 2: 168,099,023 A310V probably benign Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Plch1 C A 3: 63,711,219 D675Y probably damaging Het
Plk2 A G 13: 110,396,337 H144R probably damaging Het
Rax T A 18: 65,935,081 N318Y unknown Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Smarcd2 T A 11: 106,266,905 K138* probably null Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tango6 A G 8: 106,689,224 I226V probably benign Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tdp1 C A 12: 99,898,329 A243E probably damaging Het
Tfpt A G 7: 3,620,387 Y240H probably damaging Het
Top3b A G 16: 16,882,532 probably null Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfyve1 A T 12: 83,575,135 V162E probably damaging Het
Other mutations in Tmod4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Tmod4 APN 3 95125580 missense probably damaging 1.00
IGL01339:Tmod4 APN 3 95128297 missense probably benign 0.23
IGL01785:Tmod4 APN 3 95125618 missense probably benign
IGL02160:Tmod4 APN 3 95129113 unclassified probably benign
IGL02303:Tmod4 APN 3 95125642 missense probably benign 0.24
2107:Tmod4 UTSW 3 95130168 unclassified probably null
R0042:Tmod4 UTSW 3 95129788 missense possibly damaging 0.90
R1515:Tmod4 UTSW 3 95128679 missense possibly damaging 0.76
R4210:Tmod4 UTSW 3 95127829 missense probably benign 0.00
R6093:Tmod4 UTSW 3 95125618 missense probably benign
R6181:Tmod4 UTSW 3 95127807 missense probably damaging 1.00
R6294:Tmod4 UTSW 3 95128306 missense probably benign 0.05
R6351:Tmod4 UTSW 3 95127853 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAAACATTGAGGAGATGC -3'
(R):5'- CCTGCAGAATTGTGAGCCAG -3'

Sequencing Primer
(F):5'- CCACAAACATTGAGGAGATGCTAAAG -3'
(R):5'- TTGAGGTCTGCCATAAGAAAACATG -3'
Posted On2015-06-10