Incidental Mutation 'R4211:Phtf1'
ID319180
Institutional Source Beutler Lab
Gene Symbol Phtf1
Ensembl Gene ENSMUSG00000058388
Gene Nameputative homeodomain transcription factor 1
SynonymsPhft
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4211 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location103968110-104024598 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 104003603 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055425] [ENSMUST00000055425] [ENSMUST00000063717] [ENSMUST00000090685] [ENSMUST00000090685] [ENSMUST00000117150] [ENSMUST00000145727]
Predicted Effect probably null
Transcript: ENSMUST00000055425
SMART Domains Protein: ENSMUSP00000058137
Gene: ENSMUSG00000058388

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 60 8.6e-31 PFAM
Pfam:Phtf-FEM1B_bdg 57 105 5.2e-18 PFAM
low complexity region 117 128 N/A INTRINSIC
low complexity region 294 317 N/A INTRINSIC
transmembrane domain 470 492 N/A INTRINSIC
transmembrane domain 557 579 N/A INTRINSIC
transmembrane domain 594 611 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000055425
SMART Domains Protein: ENSMUSP00000058137
Gene: ENSMUSG00000058388

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 60 8.6e-31 PFAM
Pfam:Phtf-FEM1B_bdg 57 105 5.2e-18 PFAM
low complexity region 117 128 N/A INTRINSIC
low complexity region 294 317 N/A INTRINSIC
transmembrane domain 470 492 N/A INTRINSIC
transmembrane domain 557 579 N/A INTRINSIC
transmembrane domain 594 611 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000063717
SMART Domains Protein: ENSMUSP00000066607
Gene: ENSMUSG00000058388

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 5 151 9.9e-73 PFAM
low complexity region 155 163 N/A INTRINSIC
low complexity region 170 181 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 512 534 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
transmembrane domain 647 664 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000090685
SMART Domains Protein: ENSMUSP00000088184
Gene: ENSMUSG00000058388

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 158 8.9e-89 PFAM
low complexity region 302 325 N/A INTRINSIC
transmembrane domain 428 447 N/A INTRINSIC
transmembrane domain 467 489 N/A INTRINSIC
transmembrane domain 565 587 N/A INTRINSIC
transmembrane domain 602 619 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000090685
SMART Domains Protein: ENSMUSP00000088184
Gene: ENSMUSG00000058388

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 158 8.9e-89 PFAM
low complexity region 302 325 N/A INTRINSIC
transmembrane domain 428 447 N/A INTRINSIC
transmembrane domain 467 489 N/A INTRINSIC
transmembrane domain 565 587 N/A INTRINSIC
transmembrane domain 602 619 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117150
SMART Domains Protein: ENSMUSP00000113973
Gene: ENSMUSG00000058388

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 158 1.6e-88 PFAM
low complexity region 170 181 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 512 534 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
transmembrane domain 647 664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145727
SMART Domains Protein: ENSMUSP00000114722
Gene: ENSMUSG00000058388

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 158 1.6e-88 PFAM
low complexity region 170 181 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 512 534 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
transmembrane domain 647 664 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150090
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T G 5: 90,564,237 V63G probably damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Anapc5 T C 5: 122,817,905 E154G probably benign Het
Anpep A T 7: 79,840,996 Y257* probably null Het
Atp8b1 A T 18: 64,553,047 D688E probably damaging Het
Bub1b C A 2: 118,630,978 H670Q possibly damaging Het
Casp3 G T 8: 46,635,388 D107Y probably damaging Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cr2 A C 1: 195,156,328 L671R probably damaging Het
Cttnbp2 A G 6: 18,427,543 V713A probably damaging Het
Cyp4a31 T C 4: 115,565,013 F65L probably benign Het
Dpysl2 T C 14: 66,815,477 S308G probably damaging Het
Dusp22 A T 13: 30,708,743 I168F probably benign Het
Ecel1 A G 1: 87,152,150 S414P probably damaging Het
Fat2 A G 11: 55,283,984 F1968L probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gatsl2 T C 5: 134,125,944 probably null Het
H2-DMb1 T A 17: 34,155,573 F66I possibly damaging Het
Hgf T C 5: 16,614,993 V574A probably damaging Het
Hoxa7 A T 6: 52,216,625 Y137* probably null Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Kmt2d A G 15: 98,840,189 probably benign Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lepr C T 4: 101,733,414 A63V probably benign Het
Lmx1a G T 1: 167,832,859 V238L probably damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mcmbp T C 7: 128,716,005 E172G possibly damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Nek8 C A 11: 78,170,483 V379L probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Pard6b C T 2: 168,099,023 A310V probably benign Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Plch1 C A 3: 63,711,219 D675Y probably damaging Het
Plk2 A G 13: 110,396,337 H144R probably damaging Het
Rax T A 18: 65,935,081 N318Y unknown Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Smarcd2 T A 11: 106,266,905 K138* probably null Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tango6 A G 8: 106,689,224 I226V probably benign Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tdp1 C A 12: 99,898,329 A243E probably damaging Het
Tfpt A G 7: 3,620,387 Y240H probably damaging Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Top3b A G 16: 16,882,532 probably null Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfyve1 A T 12: 83,575,135 V162E probably damaging Het
Other mutations in Phtf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Phtf1 APN 3 103988667 missense probably benign
IGL01139:Phtf1 APN 3 104005602 missense probably damaging 1.00
IGL01677:Phtf1 APN 3 103998783 missense probably damaging 1.00
IGL02169:Phtf1 APN 3 103997499 missense probably benign
IGL02542:Phtf1 APN 3 103993906 splice site probably benign
IGL02557:Phtf1 APN 3 103998765 missense probably damaging 1.00
IGL02697:Phtf1 APN 3 103997563 missense probably benign
IGL02807:Phtf1 APN 3 103997553 missense probably benign 0.00
R0140:Phtf1 UTSW 3 103987560 missense probably null 1.00
R0555:Phtf1 UTSW 3 104004469 missense probably damaging 1.00
R0620:Phtf1 UTSW 3 103993765 missense probably damaging 1.00
R1480:Phtf1 UTSW 3 103987434 nonsense probably null
R1799:Phtf1 UTSW 3 103996642 missense probably benign 0.01
R1804:Phtf1 UTSW 3 103987567 unclassified probably benign
R1921:Phtf1 UTSW 3 103969122 nonsense probably null
R1943:Phtf1 UTSW 3 103993882 nonsense probably null
R2006:Phtf1 UTSW 3 104004483 critical splice donor site probably null
R3729:Phtf1 UTSW 3 103985779 missense probably benign 0.00
R3731:Phtf1 UTSW 3 103985779 missense probably benign 0.00
R4051:Phtf1 UTSW 3 104005508 missense possibly damaging 0.92
R4210:Phtf1 UTSW 3 104003603 critical splice donor site probably null
R4730:Phtf1 UTSW 3 103987435 missense probably damaging 1.00
R4982:Phtf1 UTSW 3 103998708 missense probably damaging 1.00
R5314:Phtf1 UTSW 3 103999287 missense probably damaging 1.00
R5321:Phtf1 UTSW 3 104003511 missense probably benign 0.31
R5499:Phtf1 UTSW 3 103991175 missense probably benign 0.00
R6134:Phtf1 UTSW 3 104004405 missense probably damaging 0.99
R6603:Phtf1 UTSW 3 103993873 missense probably damaging 1.00
R7242:Phtf1 UTSW 3 103998696 missense probably damaging 0.99
R7311:Phtf1 UTSW 3 103997664 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TCAGCTCTTGTCCTTTGAGG -3'
(R):5'- TAGCAAAGTACTCTCAACCCATTAG -3'

Sequencing Primer
(F):5'- CCTTTGAGGAAACTGTAGATTGC -3'
(R):5'- AACCCATTAGCTCATTCTCCCAG -3'
Posted On2015-06-10