Incidental Mutation 'R4211:Man1c1'
ID319185
Institutional Source Beutler Lab
Gene Symbol Man1c1
Ensembl Gene ENSMUSG00000037306
Gene Namemannosidase, alpha, class 1C, member 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.684) question?
Stock #R4211 (G1)
Quality Score196
Status Not validated
Chromosome4
Chromosomal Location134561690-134704290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 134703438 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 11 (P11R)
Ref Sequence ENSEMBL: ENSMUSP00000050979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038628] [ENSMUST00000054096]
Predicted Effect probably damaging
Transcript: ENSMUST00000038628
AA Change: P11R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037949
Gene: ENSMUSG00000037306
AA Change: P11R

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
Pfam:Glyco_hydro_47 176 612 9.9e-147 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054096
AA Change: P11R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050979
Gene: ENSMUSG00000037306
AA Change: P11R

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
Pfam:Glyco_hydro_47 176 612 1.1e-147 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176606
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T G 5: 90,564,237 V63G probably damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Anapc5 T C 5: 122,817,905 E154G probably benign Het
Anpep A T 7: 79,840,996 Y257* probably null Het
Atp8b1 A T 18: 64,553,047 D688E probably damaging Het
Bub1b C A 2: 118,630,978 H670Q possibly damaging Het
Casp3 G T 8: 46,635,388 D107Y probably damaging Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cr2 A C 1: 195,156,328 L671R probably damaging Het
Cttnbp2 A G 6: 18,427,543 V713A probably damaging Het
Cyp4a31 T C 4: 115,565,013 F65L probably benign Het
Dpysl2 T C 14: 66,815,477 S308G probably damaging Het
Dusp22 A T 13: 30,708,743 I168F probably benign Het
Ecel1 A G 1: 87,152,150 S414P probably damaging Het
Fat2 A G 11: 55,283,984 F1968L probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gatsl2 T C 5: 134,125,944 probably null Het
H2-DMb1 T A 17: 34,155,573 F66I possibly damaging Het
Hgf T C 5: 16,614,993 V574A probably damaging Het
Hoxa7 A T 6: 52,216,625 Y137* probably null Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Kmt2d A G 15: 98,840,189 probably benign Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lepr C T 4: 101,733,414 A63V probably benign Het
Lmx1a G T 1: 167,832,859 V238L probably damaging Het
Mcmbp T C 7: 128,716,005 E172G possibly damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Nek8 C A 11: 78,170,483 V379L probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Pard6b C T 2: 168,099,023 A310V probably benign Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Plch1 C A 3: 63,711,219 D675Y probably damaging Het
Plk2 A G 13: 110,396,337 H144R probably damaging Het
Rax T A 18: 65,935,081 N318Y unknown Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Smarcd2 T A 11: 106,266,905 K138* probably null Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tango6 A G 8: 106,689,224 I226V probably benign Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tdp1 C A 12: 99,898,329 A243E probably damaging Het
Tfpt A G 7: 3,620,387 Y240H probably damaging Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Top3b A G 16: 16,882,532 probably null Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfyve1 A T 12: 83,575,135 V162E probably damaging Het
Other mutations in Man1c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Man1c1 APN 4 134564532 missense probably damaging 1.00
IGL02237:Man1c1 APN 4 134584298 critical splice donor site probably null
R0201:Man1c1 UTSW 4 134640398 splice site probably null
R0390:Man1c1 UTSW 4 134578315 missense probably damaging 1.00
R0526:Man1c1 UTSW 4 134569068 nonsense probably null
R1108:Man1c1 UTSW 4 134564613 missense probably damaging 1.00
R1518:Man1c1 UTSW 4 134580789 missense probably benign 0.01
R1756:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R1866:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R1914:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R1915:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R2171:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R2172:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R2937:Man1c1 UTSW 4 134702952 missense possibly damaging 0.72
R2938:Man1c1 UTSW 4 134702952 missense possibly damaging 0.72
R2971:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R3806:Man1c1 UTSW 4 134703351 missense probably damaging 1.00
R3977:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R3979:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R4037:Man1c1 UTSW 4 134593339 missense probably damaging 1.00
R4065:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R4066:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R4067:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R4209:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R4210:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R4290:Man1c1 UTSW 4 134563785 missense probably damaging 1.00
R4431:Man1c1 UTSW 4 134703018 missense probably damaging 1.00
R4694:Man1c1 UTSW 4 134703189 missense probably benign 0.27
R4766:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R5226:Man1c1 UTSW 4 134578369 missense probably damaging 1.00
R5637:Man1c1 UTSW 4 134591424 missense probably damaging 1.00
R5677:Man1c1 UTSW 4 134569060 missense probably damaging 1.00
R5939:Man1c1 UTSW 4 134565836 missense probably damaging 0.99
R7251:Man1c1 UTSW 4 134580836 missense probably damaging 1.00
X0019:Man1c1 UTSW 4 134576007 missense probably damaging 1.00
X0062:Man1c1 UTSW 4 134703372 missense possibly damaging 0.74
X0063:Man1c1 UTSW 4 134575977 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTTCCTACGGAGAACAC -3'
(R):5'- TCCAAACTCCCTGAACTTCGG -3'

Sequencing Primer
(F):5'- TCCTGCTCTGACACCGAGTG -3'
(R):5'- TGAACTTCGGGCGGGTC -3'
Posted On2015-06-10